View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_high_39 (Length: 249)
Name: NF0931_high_39
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_high_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 53744502 - 53744344
Alignment:
| Q |
1 |
ctcctcgctcttgctctgtaatttcaatttctgttactcaacagagttgatcgtgaaattgtagttgttgttcttggatctagctaaggagattatgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53744502 |
ctcctcgctcttgctctgtaatttcaatttctgtcagtcaacagagttgatcgtgaaattgtagttgttgttcttggatctagctaaggagattatgaaa |
53744403 |
T |
|
| Q |
101 |
ttagtgatgataagtgttgttttcaaggattgattgaagttcaatttgtgaattgctgc |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53744402 |
ttagtgatgataagtgttgttttcaaggattgattgaagttcaatttgtgaattgctgc |
53744344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University