View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_high_41 (Length: 245)
Name: NF0931_high_41
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_high_41 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 52477516 - 52477748
Alignment:
| Q |
11 |
cagagaagtgtcttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaaggacaaaaccagcatgagagtcagagtca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52477516 |
cagagaagtgtcttgcgttttgttttgaagatgcaattgtgactagaagtgataaggaacataagttccaaggacaaaaccagcatgagagtcag--tca |
52477613 |
T |
 |
| Q |
111 |
aaaataaatcaagtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacctttggtactgttgatggcagccatgaagtgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477614 |
aaaataaatcaagtgaaataacggatttggttaccggaggcggcgaagtcggacaaattcatagacacctttggtactgttgatggcagccatgaagtgc |
52477713 |
T |
 |
| Q |
211 |
agtgtctctcctatgaagggtaatcctcgatttcc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52477714 |
agtgtctctcctatgaagggtaatcctcgatttcc |
52477748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University