View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_high_46 (Length: 228)
Name: NF0931_high_46
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0931_high_46 |
 |  |
|
[»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 14224762 - 14224984
Alignment:
Q |
6 |
acacagttgttcactatacattttaaaaagcgacaactgaaattaaaaagtaaacaaacccttggtatcacgattttaatttcatcattccttatttagt |
105 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14224762 |
acacagttgttcactatacattttaaaaagcgacagctgaaattaaaaagtaaacaaacccttggtatcacgattttaatttcatcattccttatttagt |
14224861 |
T |
 |
Q |
106 |
atcacatgtcttccctagcttatctaggatgagaatattggtgatttccttttgattcaacttgaatatcctctaaaaatagaagaaactttatttggaa |
205 |
Q |
|
|
||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14224862 |
atcccatgtcttgcctagcttatctaggatgagaatattggtgatttccttttgattcaacttgaatatcctctaaaaatagaagaaactttatttggaa |
14224961 |
T |
 |
Q |
206 |
atttagttaacttctttaccttt |
228 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
14224962 |
atttagttaacttctttaccttt |
14224984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 135 - 225
Target Start/End: Original strand, 14232103 - 14232194
Alignment:
Q |
135 |
tgagaatattggtgatttccttttgattcaacttgaatatcctctaaaaatagaagaaactttatttgg-aaatttagttaacttctttacc |
225 |
Q |
|
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||| | ||||||||| |||||||||||||||||||||| |
|
|
T |
14232103 |
tgagaatatcggtgatttccttttgattcaaattgaatatcctctaaaaataaaagagaatttatttggaaaatttagttaacttctttacc |
14232194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University