View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0931_high_48 (Length: 226)

Name: NF0931_high_48
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0931_high_48
NF0931_high_48
[»] chr4 (1 HSPs)
chr4 (1-133)||(39883068-39883200)


Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 39883068 - 39883200
Alignment:
1 tcaacttcaaagtagtttgaagctgctacaagctttatgttaatatatcgtgattggtctatatcaatgaaacataaagcttgtgatgcatgagattgtg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
39883068 tcaacttcaaagtagtttgaagctgctacaagctttatgttaatatatcgtgattggtctatatcaatgaaacataaagcttgtgatgtatgagattgtg 39883167  T
101 aagatacgaagtagctttggtcctagggtaatt 133  Q
    |||||||||||||||||||||||||||||||||    
39883168 aagatacgaagtagctttggtcctagggtaatt 39883200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University