View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_low_10 (Length: 454)
Name: NF0931_low_10
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 134 - 394
Target Start/End: Original strand, 2018327 - 2018587
Alignment:
| Q |
134 |
gtctcgtccaaagattacggaattaacccttgcacaatattaaccctacaaaaataaaactagggttcacacttatacctcgctgtgaacaagaacaacc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018327 |
gtctcgtccaaagattacggaattaacccttgcacactattaaccctacaaaaataaaactagggttcacacttatacctcgctgtgaacaagaacaacc |
2018426 |
T |
 |
| Q |
234 |
atggaatcactacctgacgacgttctgtatcacattctgtcgttccttccgacgagggatgctgttgctactagccttctgtcaaagagatggaaaccac |
333 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018427 |
atggaatcactacctgacgacgttctgtgtcacattctgtcgttccttccgacgagggatgctgttgctactagccttctgtcaaagagatggaaaccac |
2018526 |
T |
 |
| Q |
334 |
tctggctctccctccgttccttcgaccttgatgacaactacttttccgacttccacaggtt |
394 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018527 |
tctggctctccttccgttccttcgaccttgatgacaactacttttccgacttccacaggtt |
2018587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 243 - 358
Target Start/End: Original strand, 2005585 - 2005700
Alignment:
| Q |
243 |
ctacctgacgacgttctgtatcacattctgtcgttccttccgacgagggatgctgttgctactagccttctgtcaaagagatggaaaccactctggctct |
342 |
Q |
| |
|
||||||||||| ||| | |||||||||||| | |||||||||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2005585 |
ctacctgacgatcttcgatgtcacattctgtcatgccttccgacgagagatgcgtctgctactagccttctgtcaaagagatggaaaccactttggctct |
2005684 |
T |
 |
| Q |
343 |
ccctccgttccttcga |
358 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
2005685 |
cactccgttccttcga |
2005700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 246 - 355
Target Start/End: Original strand, 2011762 - 2011871
Alignment:
| Q |
246 |
cctgacgacgttctgtatcacattctgtcgttccttccgacgagggatgctgttgctactagccttctgtcaaagagatggaaaccactctggctctccc |
345 |
Q |
| |
|
|||||||| |||| || ||||||||| || |||||||| ||||| ||||||| |||||| || ||||| |||||||||||||||||||| |||||||| | |
|
|
| T |
2011762 |
cctgacgatgttcggtgtcacattctctcattccttccaacgagagatgctgctgctacaagtcttctatcaaagagatggaaaccactttggctctcgc |
2011861 |
T |
 |
| Q |
346 |
tccgttcctt |
355 |
Q |
| |
|
|||||||||| |
|
|
| T |
2011862 |
tccgttcctt |
2011871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 401 - 453
Target Start/End: Complemental strand, 2018416 - 2018364
Alignment:
| Q |
401 |
gttcactgcgaggtataagtgtgaaccctatttttatttttgtagggttaata |
453 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2018416 |
gttcacagcgaggtataagtgtgaaccctagttttatttttgtagggttaata |
2018364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University