View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_low_19 (Length: 381)
Name: NF0931_low_19
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0931_low_19 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 87 - 381
Target Start/End: Complemental strand, 14225635 - 14225340
Alignment:
Q |
87 |
tacttgattacaagtttgaattttggtatgcaatgctcttgaaaatccaaatcttatgatacgtatcaggttatgataaaaaa-taaaccagcacagtca |
185 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||||||||| |||| |
|
|
T |
14225635 |
tacttgattacaaatttgaattttggtatgcaatgctcttgaaattccaaatcttatgatacttatcaggttatcataaaaaaataaaccagcacggtca |
14225536 |
T |
 |
Q |
186 |
aacagctcgaatagtaagaggtttaagagtgatgtggtggtcgtgctagagataactcggcaaacagctgacccttcatctaatccttcacctttgcttg |
285 |
Q |
|
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14225535 |
aacagctcgaatggtgagaggtttaagagtgatgtggtggtcgtgctagagataactcggcaaacagctgacccttcatctaatccttcacctttgcttg |
14225436 |
T |
 |
Q |
286 |
gaccatctttactctcccatccctcaccatttcctgaaccatctttgttatcccatccttcaactttgcctggaatgtcgtttttatcctatcctt |
381 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
14225435 |
gaccatctttactctcccatccttcaccatttcctgaaccatctttgttatcccatccttcaactttgcatggaatgtcgtttttatcctatcctt |
14225340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University