View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_low_2 (Length: 585)
Name: NF0931_low_2
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 2e-29; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 58 - 140
Target Start/End: Original strand, 27985981 - 27986063
Alignment:
| Q |
58 |
caaacttctcttgtgcagtgtttgggaatatgcagtggaagttcgaacttcaaattctagaagatcttgccccagttcctttt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
27985981 |
caaacttctcttgtgcagtgtttgggaatgtgtagtggaagttcgaatttcaaattctagaagatcttgccctagttcctttt |
27986063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 14 - 64
Target Start/End: Original strand, 27985899 - 27985949
Alignment:
| Q |
14 |
agaaggtggtgctggtggatatattgtcattctcatgtctcacacaaactt |
64 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27985899 |
agaaggtggtgctggtgtatatattgtcattctcatgtctcacacaaactt |
27985949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 513 - 556
Target Start/End: Original strand, 27986060 - 27986103
Alignment:
| Q |
513 |
ttttttcttgatgtttctcaaggagtacaaacgtgagacatgta |
556 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27986060 |
ttttttcttgatgtttcttaaggagtacaaacgtgagacatgta |
27986103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 279 - 424
Target Start/End: Complemental strand, 42303653 - 42303506
Alignment:
| Q |
279 |
tcttctgattttattaagtcattatatct---aattcaaaatttttgatgtagttggggggttatgctcccattcttgtccctttcaattctattccttg |
375 |
Q |
| |
|
|||||||||||||| ||||||||| || ||||||||| |||| ||| |||||||| || | ||| |||||||||||||||||| ||| |||| |
|
|
| T |
42303653 |
tcttctgattttatcaagtcattacattagtaaattcaaaaaatttggtgtggttgggggttt-tactctgattcttgtccctttcaatgttatcccttt |
42303555 |
T |
 |
| Q |
376 |
ccttagtaatatcaagaactgtatcatttcttgttgatgatgctaaagg |
424 |
Q |
| |
|
|||||||||||||||| || |||| || ||||||||||| ||||||| |
|
|
| T |
42303554 |
gcttagtaatatcaagaccttgatcactttttgttgatgattctaaagg |
42303506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 377 - 438
Target Start/End: Complemental strand, 10506296 - 10506235
Alignment:
| Q |
377 |
cttagtaatatcaagaactgtatcatttcttgttgatgatgctaaaggcctacgaattggag |
438 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||| | |||||| | ||||| |||| |
|
|
| T |
10506296 |
cttagtaatatcaagaactggttcattttttgttgatgattcgaaaggcgtgcgaatcggag |
10506235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University