View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_low_25 (Length: 348)
Name: NF0931_low_25
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 29 - 314
Target Start/End: Complemental strand, 42285934 - 42285661
Alignment:
| Q |
29 |
aattgcaaaacaataggttgagttgctatgcaaagggaacatttaaggtgaaggttaatatgtggattttacattcatctttttggcttcatagtgtgtg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42285934 |
aattgcaaaacaataggttgagttgctatgcaaagggaacatttaaggtgaaggttaatatgtggattttacattcatctttttggcttcatagtgtgtg |
42285835 |
T |
|
| Q |
129 |
ccagattgagatgactggtccaccaaatggttctcttgtagctagacaatgcataacaactcgatgaagagggagggtagattttatttttatgcttgtt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42285834 |
ccagattgagatgactggtccaccaaatggttctcttgtagctagacaatgcataacaactcgatgaagagggagggtagatttta------------tt |
42285747 |
T |
|
| Q |
229 |
taatgttttctagtttatatactattcgaatatatattgtatattaatcatgtcatatgtgcacaaagagtgatatgattcatctc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42285746 |
taatgttttctagtttatatactattcgaatatatattgtatattaatcatgtcatgtgtgcacaaagagtgatatgattcatctc |
42285661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University