View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_low_26 (Length: 348)
Name: NF0931_low_26
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 91 - 342
Target Start/End: Original strand, 748911 - 749162
Alignment:
| Q |
91 |
aaaagggactttgtgccttgagtttcttaactattaaggtaatgctccaatccttgtcgtccaaactataatgttttatttaattattttctcacctttc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
748911 |
aaaagggactttgtgccttgagtttcttaactattaagttaatgctccaatccttgtcgtccaaactataatgtttcatttaattattttctcacctttc |
749010 |
T |
 |
| Q |
191 |
tactatataatcatgtcactaaaaagttcccacttattcttcctattttattgttcataattcttttttggagttataaattgctctctttttaatctag |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
749011 |
tactatataatcatgtcactaaaaagttcccacttattcttcctattctattgttcataattcttttttggagttataaattgctctctttttaatctag |
749110 |
T |
 |
| Q |
291 |
atacgttatgggataggaaaataactttaattgtgcgtacaacctatgctac |
342 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
749111 |
atacgttatgggttaggaaaataactttaattgtgcgtacaacttatgctac |
749162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University