View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_low_45 (Length: 273)
Name: NF0931_low_45
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_low_45 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 34 - 273
Target Start/End: Complemental strand, 1173004 - 1172768
Alignment:
| Q |
34 |
atgaagttgctttatttctttggtaacacttcatataaatacctcaaccctactt--gaaggaatacatacatcttcttgagggaaacaaaaagagtcag |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
1173004 |
atgaagttgctttatttctttggtaacacttcatataaatacctcaaccctacttaagaacgaatacataaatgttcttgagggaaacaaaaagagtcag |
1172905 |
T |
 |
| Q |
132 |
tcgatattgagagttataatcgtcgtttaatttgcttgttattcacaattcttcactttgtttcaagtttctcactttcaggtatgcatattaaactctt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1172904 |
tcgatattgagagttataatcgtcgttt-----gcttgttattcacaattcttcactttgtttcaagtttctcactttcaggtatgcatattaaactctt |
1172810 |
T |
 |
| Q |
232 |
aatattaatttcagcatgtatatatattatcgctatcgaatt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1172809 |
aatattaatttcagcatgtatatatattatcgctatcgaatt |
1172768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 101 - 140
Target Start/End: Complemental strand, 1165149 - 1165110
Alignment:
| Q |
101 |
acatcttcttgagggaaacaaaaagagtcagtcgatattg |
140 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
1165149 |
acatcttcttgagggaaaccaaaagagtcagtcgacattg |
1165110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 174 - 216
Target Start/End: Complemental strand, 1182525 - 1182482
Alignment:
| Q |
174 |
tcacaattcttcactttgtttcaagtttctca-ctttcaggtat |
216 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1182525 |
tcacaagtcttcactttgtttcaagtttctcacctttcaggtat |
1182482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University