View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_low_50 (Length: 254)
Name: NF0931_low_50
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_low_50 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 33 - 254
Target Start/End: Original strand, 51688399 - 51688634
Alignment:
| Q |
33 |
catgagacccctcttgggg--ggttctgttaaacgattccatatttttccttacttcattcaccagttacatcacctacagttattattagggacaaggt |
130 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51688399 |
catgagacccctcttggggggggttctgttaaacgattccatatttttccttacttcattcaccagttacatcacctacagttattattagggacaaggt |
51688498 |
T |
 |
| Q |
131 |
aacatgcatcatgtacaaaagtacaaccacagcaaacatttaagtactttgcatgctggcgctaaatttgcat------------tctctctctttccca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51688499 |
aacatgcatcatgtacaaaagtacaaccacagcaaacatttaagtactttgtatgctggcgctaaatttgcattttagttacacctctctctctttccca |
51688598 |
T |
 |
| Q |
219 |
cgggtccttaatcagtgcccaggatactagttagca |
254 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||| |
|
|
| T |
51688599 |
cgggtccttaattagtgcccagagtactagttagca |
51688634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University