View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_low_51 (Length: 252)
Name: NF0931_low_51
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_low_51 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 147 - 241
Target Start/End: Original strand, 28963075 - 28963169
Alignment:
| Q |
147 |
agaaaaatgctttatggtacgagagcaaaccatgcacgacaacttaagaatgaattgctgctcttgaatttttatctttcttttaactaattcat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
28963075 |
agaaaaatgctttatggtacgagagcaaaccatgcacgacaacttaggaatgaattgctgaccttggatttttatctttcctttaactaattcat |
28963169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 148 - 241
Target Start/End: Complemental strand, 3442843 - 3442750
Alignment:
| Q |
148 |
gaaaaatgctttatggtacgagagcaaaccatgcacgacaacttaagaatgaattgctgctcttgaatttttatctttcttttaactaattcat |
241 |
Q |
| |
|
|||||||||||||| | |||||| ||||||||||||||||||||| |||||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
3442843 |
gaaaaatgctttattgcacgagaacaaaccatgcacgacaacttacgaatgaattgctgcccttggatttttatctttccattaactaattcat |
3442750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 153 - 241
Target Start/End: Complemental strand, 24115931 - 24115842
Alignment:
| Q |
153 |
atgctttatggtacgagagcaaacc-atgcacgacaacttaagaatgaattgctgctcttgaatttttatctttcttttaactaattcat |
241 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| |||||||||||| | |||| ||||||||||||| ||||| |||||||| |
|
|
| T |
24115931 |
atgctttatggtacgagaacaaacccatgcacgacaacttgcgaatgaattgcttcccttggatttttatctttcatttaattaattcat |
24115842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 148 - 225
Target Start/End: Complemental strand, 26683875 - 26683799
Alignment:
| Q |
148 |
gaaaaatgctttatggtacgagagcaaaccatgcacgacaacttaagaatgaattgctgctcttgaatttttatcttt |
225 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||| ||| || ||||||||||||||||| |
|
|
| T |
26683875 |
gaaaaatgctttatggtacaagagcaaaccatgcacgacaacttgcaaatgaa-tgccgcccttgaatttttatcttt |
26683799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 109
Target Start/End: Original strand, 4745325 - 4745392
Alignment:
| Q |
42 |
attgcacaatttctgtgatgggcagagagataagtgagtagtaaatgaagtttagaacaattttaaag |
109 |
Q |
| |
|
|||||||||||| | |||| ||||||||||| |||| ||||||| |||||||| |||||| ||||||| |
|
|
| T |
4745325 |
attgcacaatttatatgattggcagagagatgagtgggtagtaagtgaagtttggaacaactttaaag |
4745392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University