View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_low_57 (Length: 251)
Name: NF0931_low_57
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 47508935 - 47508695
Alignment:
| Q |
1 |
caaacttcaatatatcattgtaacattaaagatagccagccatctaactcataaattaacagagaatgctgaatagatcttccggtattgctcatatctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47508935 |
caaacttcaatatatcattgtaacattaaagatagccagccatctaactcataaattaacagagattgctgaatagatcttccggtattgctcatatctt |
47508836 |
T |
|
| Q |
101 |
gttatataattttttctcaaagaactgatcagaagttatcctccgatgaatgttttgagggnnnnnnngcagtaatgcagggggtttgtacaacaataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47508835 |
gttatataattttttctcaaagaactgatcagaagttatcttccgatgagtgttttgaggggttttttgcagtaatgcagggggtttgtacaacaataat |
47508736 |
T |
|
| Q |
201 |
ctaaattaataatcaagaagaggataaagtagtgattcatctca |
244 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||| ||||| |
|
|
| T |
47508735 |
ctaaattaatactc---aagaggataaagtagtgattcttctca |
47508695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University