View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_low_64 (Length: 240)
Name: NF0931_low_64
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 55178838 - 55178637
Alignment:
| Q |
16 |
gtctgttgtacaatgggtaatgaacttaccggatcgctcaacacacaaatataataacaatcgacacagttcatctcaaattgagggccagagctataaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55178838 |
gtctgttgtacaatgggtaatgaacttaccggatcgctcaacacacaaatataataacaatcgacacagttcatctcaaattgagggccagagctataaa |
55178739 |
T |
|
| Q |
116 |
aatgttattagtttcagtagctgcaagtggtttatctttgaggttctcaactcttgcacttgtcaattctcttcaggtcagactcataacatctctgctg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
55178738 |
aatgttattagtttcagtagctgcaagtggtttatctttgaggttctcaactcttgcacttgtcaattctcttcaggtcggactcataacatcactgctg |
55178639 |
T |
|
| Q |
216 |
ct |
217 |
Q |
| |
|
|| |
|
|
| T |
55178638 |
ct |
55178637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University