View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_low_66 (Length: 237)
Name: NF0931_low_66
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0931_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 214
Target Start/End: Complemental strand, 55178838 - 55178640
Alignment:
Q |
16 |
gtctgttgtacaatgggtaatgaacttaccggatcgctcaacacacaaatataataacaatcgacacagttcatctcaaattgagggccagagctataaa |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55178838 |
gtctgttgtacaatgggtaatgaacttaccggatcgctcaacacacaaatataataacaatcgacacagttcatctcaaattgagggccagagctataaa |
55178739 |
T |
 |
Q |
116 |
aatgttattagtttcagtagctgcaagtggtttatctttgaggttctcaactcttgcacttgtcaattctcttcaggtcagactcataacatctctgct |
214 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
T |
55178738 |
aatgttattagtttcagtagctgcaagtggtttatctttgaggttctcaactcttgcacttgtcaattctcttcaggtcggactcataacatcactgct |
55178640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University