View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0931_low_67 (Length: 237)
Name: NF0931_low_67
Description: NF0931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0931_low_67 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 78 - 237
Target Start/End: Complemental strand, 24620313 - 24620154
Alignment:
| Q |
78 |
gttaagactagtctttcatgtctattttaaagttgatttgattttgtagaatatattttgaaaaattgtaaactaaatttggctataccttgaaaataat |
177 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
24620313 |
gttaaaactagtctttcatgtctattttaaagttgatttgattttatagaatgtgttttgaaaaattgtaaactaaatttggatatacattgaaaataat |
24620214 |
T |
 |
| Q |
178 |
aattcaaagaaatttgttccaaattaaaatcttagtttataaaattcaattagatggaaa |
237 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24620213 |
aattcaaagaaatttgatccaaattaaaatcttagtttatcaaattcaattagatggaaa |
24620154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University