View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_high_11 (Length: 305)
Name: NF0934_high_11
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 153 - 228
Target Start/End: Original strand, 45647128 - 45647203
Alignment:
| Q |
153 |
ggaactaattatttccagcttatcgatccttataattaatcttgcttatataagtaataattagcatgaaagttat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45647128 |
ggaactaattatttccagcttatcgatccttataattaatcttgcttatataagtaataattagcatgaaagttat |
45647203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 87
Target Start/End: Original strand, 45647028 - 45647062
Alignment:
| Q |
53 |
tatcataggtgttggtaggccaaattacatgattg |
87 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45647028 |
tatcaaaggtgttggtaggccaaattacatgattg |
45647062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University