View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0934_high_11 (Length: 305)

Name: NF0934_high_11
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0934_high_11
NF0934_high_11
[»] chr7 (2 HSPs)
chr7 (153-228)||(45647128-45647203)
chr7 (53-87)||(45647028-45647062)


Alignment Details
Target: chr7 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 153 - 228
Target Start/End: Original strand, 45647128 - 45647203
Alignment:
153 ggaactaattatttccagcttatcgatccttataattaatcttgcttatataagtaataattagcatgaaagttat 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45647128 ggaactaattatttccagcttatcgatccttataattaatcttgcttatataagtaataattagcatgaaagttat 45647203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 87
Target Start/End: Original strand, 45647028 - 45647062
Alignment:
53 tatcataggtgttggtaggccaaattacatgattg 87  Q
    ||||| |||||||||||||||||||||||||||||    
45647028 tatcaaaggtgttggtaggccaaattacatgattg 45647062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University