View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_high_18 (Length: 259)
Name: NF0934_high_18
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 47454582 - 47454315
Alignment:
| Q |
1 |
cttttcagtttttgtaacattttatgttatcatttttatcgatcaaagctactgatgaagattttatcgatatat------------acattttaagtag |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47454582 |
cttttcagtttttgtaacattttatgttatcatttttatcgatcaaagccactgatgaagattttatcgatatatcatatcatatatacattttaagtag |
47454483 |
T |
 |
| Q |
89 |
atatgatatgatataataatttgacttattgttatgatgatttgataatgttggttctttctttctagttgaagagatgaaaaacagtatcctaaattga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47454482 |
atatgatatgatataataatttgacttattgttatggtgatttgataatgttggttctttctttctagttgaagagatgaaaaacagtatcctaaattga |
47454383 |
T |
 |
| Q |
189 |
tagattttcaactacctagtttctctctttaccactcactctaactactttctatttcttttctgtcg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47454382 |
tagattttcaactacctagtttctctctttaccactcactctaactactttctatttctattctgtcg |
47454315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University