View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_high_22 (Length: 247)
Name: NF0934_high_22
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 26 - 244
Target Start/End: Original strand, 40194711 - 40194929
Alignment:
| Q |
26 |
gatattccatatttagtttacgataaaagttgggtaaaattgtttaggtcttattggttatgtttatttctaaaattagtgttaaaatactagtaaaaaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40194711 |
gatattccatatttagtttacgataaaagttgggtaaaattgtttaggtcttattggttatgtttatttctaaaattagtgttaaaatactagtaaaaaa |
40194810 |
T |
 |
| Q |
126 |
ctatttaagaaacacactcctaaaaataggtcattgtgatgatcagattgttagtagataatatataaatatatttgtcaatactctcaatttttgagat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40194811 |
ctatttaagaaacacactcctaaaaataggtcattgtgatgatcagattgttagtagataatatataaatatatttgtcaatactctcaattattgagat |
40194910 |
T |
 |
| Q |
226 |
ttttctttgcattggtgag |
244 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40194911 |
ttttctttgcattggtgag |
40194929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University