View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_high_26 (Length: 211)
Name: NF0934_high_26
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0934_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 31829996 - 31830110
Alignment:
Q |
1 |
gtaagcaaatggttgggatatttctaacagtttgggtgaaaagcaatattagagatgatgttcgcaatatgaaagtgtcttgcgttggcagagggttgat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
31829996 |
gtaagcaaatggttgggatatttctaacagtttgggtgaaaagcaatattagagatgatgttcgcaatatgaaagtgtcttgcgttggcagaggtttgat |
31830095 |
T |
 |
Q |
101 |
gggatacctcggaaa |
115 |
Q |
|
|
||||||||||||||| |
|
|
T |
31830096 |
gggatacctcggaaa |
31830110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 38122568 - 38122454
Alignment:
Q |
1 |
gtaagcaaatggttgggatatttctaacagtttgggtgaaaagcaatattagagatgatgttcgcaatatgaaagtgtcttgcgttggcagagggttgat |
100 |
Q |
|
|
||||||||||||| ||| ||||||||||||||||||||||||| |||| |||||||| |||| || |||||||||||||| ||||| ||||| ||||| |
|
|
T |
38122568 |
gtaagcaaatggtaggggtatttctaacagtttgggtgaaaagtgatatcagagatgacgttcataacatgaaagtgtcttgtgttggaagaggattgat |
38122469 |
T |
 |
Q |
101 |
gggatacctcggaaa |
115 |
Q |
|
|
|||||| || ||||| |
|
|
T |
38122468 |
gggatatcttggaaa |
38122454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University