View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_high_6 (Length: 421)
Name: NF0934_high_6
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_high_6 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 2e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 352 - 421
Target Start/End: Complemental strand, 48714824 - 48714755
Alignment:
| Q |
352 |
atagataataaagatgacaaaatacggatgattcaattagaatacataatcattaaatttgtgatgaaca |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48714824 |
atagataataaagatgacaaaatacggatgattcaattagaatacataatcattaaatttgtgatgaaca |
48714755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 30 - 64
Target Start/End: Complemental strand, 48714874 - 48714840
Alignment:
| Q |
30 |
tttcacttattgggtgggttggggagtaaacatat |
64 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
48714874 |
tttctcttattgggtgggttggggagtaaacatat |
48714840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University