View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0934_low_15 (Length: 421)

Name: NF0934_low_15
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0934_low_15
NF0934_low_15
[»] chr3 (2 HSPs)
chr3 (352-421)||(48714755-48714824)
chr3 (30-64)||(48714840-48714874)


Alignment Details
Target: chr3 (Bit Score: 70; Significance: 2e-31; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 352 - 421
Target Start/End: Complemental strand, 48714824 - 48714755
Alignment:
352 atagataataaagatgacaaaatacggatgattcaattagaatacataatcattaaatttgtgatgaaca 421  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48714824 atagataataaagatgacaaaatacggatgattcaattagaatacataatcattaaatttgtgatgaaca 48714755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 30 - 64
Target Start/End: Complemental strand, 48714874 - 48714840
Alignment:
30 tttcacttattgggtgggttggggagtaaacatat 64  Q
    |||| ||||||||||||||||||||||||||||||    
48714874 tttctcttattgggtgggttggggagtaaacatat 48714840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University