View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_low_16 (Length: 417)
Name: NF0934_low_16
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 31 - 333
Target Start/End: Complemental strand, 14997010 - 14996708
Alignment:
| Q |
31 |
caccactacttcccttttcttccccaacccatttacctctcaaaccaacaagaaaagactaaccgccaagaagaacctcctcaccctcatctctgaccaa |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14997010 |
caccactacttcccttttcttccccaacccattcacctctcaaaccaacaagaaaagactaaccgccaagaagaacctcctcaccctcatctctgaccaa |
14996911 |
T |
|
| Q |
131 |
gaccgtggcctcaagacccnnnnnnnccccaccaagctagcatcgatcgttaccgcgatcgatgcaatggccgagcttggcaccggtacagtaaccaccg |
230 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14996910 |
gaccgtggcctcaagacccaaaaaaatcccaccaagctagcttcgatcgttaccgcgatcgatgcaatggccgagcttggcaccggtttagtaaccaccg |
14996811 |
T |
|
| Q |
231 |
gcgattccctgtcggcaacttggcggttgctctggactactgagaaggagcagctgttcatcattgagaaggctggcttgtttggaactaaaactgatga |
330 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14996810 |
gtgattccctgtcggcaacttggcggttgctctggactactgagaaagagcagctgttcatcattgagaaggctggcttgtttggaactaaaactggtga |
14996711 |
T |
|
| Q |
331 |
tgt |
333 |
Q |
| |
|
||| |
|
|
| T |
14996710 |
tgt |
14996708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University