View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_low_23 (Length: 367)
Name: NF0934_low_23
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 30 - 355
Target Start/End: Original strand, 43092126 - 43092448
Alignment:
| Q |
30 |
gatatcaaacactaagcaatgctaggtgcagtagtaaatttaattctatgtctgaaaagtacagacaaattaaattgtgtttctgatgcagtaaaccagt |
129 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43092126 |
gatatcaaacactaagcaatgctagatgcagtagtaaatttaattctatgtctgaaaagtacagacaaattaaattgtgtttctgatgtagtaaaccagt |
43092225 |
T |
 |
| Q |
130 |
atatatagattttacatatagtnnnnnnnnnnnnnnnttcataagttttatcttttttgatttatgtccctctattaaaagtaatttgaccggattagac |
229 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43092226 |
atatatagattttacatatagtaaaaagagtaaaaaagtcataagttttatcttttttgatttatgtccctctattaaaagtaatttgaccggattagac |
43092325 |
T |
 |
| Q |
230 |
ccaaatcataagaagaacggattgcaagactggatcgtgttttgaacaccctagttaattgttttggaagttttagggattaaaatcaaagtaatttatt |
329 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43092326 |
ccaaatcataaga---acggattgcaagactggatcgtgttttgaacaccctagttaattgttttgggagttttagggattaaaatcaaagtaatttatt |
43092422 |
T |
 |
| Q |
330 |
ttgcaaggcctaaaatataattcagc |
355 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43092423 |
ttgcaaggcctaaaatataattcagc |
43092448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University