View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_low_28 (Length: 313)
Name: NF0934_low_28
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 7e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 91 - 250
Target Start/End: Complemental strand, 9642210 - 9642051
Alignment:
| Q |
91 |
atatatatatgatgaaagagaggtttatggaagaaaataagaaagctcattcatataaggaattgaccttaaagatagggaaacatttcccagcagtgaa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9642210 |
atatatatatgatgaaagagaggtttatggaagaaaataagaaagttcattcatataaggaattgaccttaaagatagggaaacatttcccagcagtgaa |
9642111 |
T |
|
| Q |
191 |
gcaaacttaacatatatatgaaatgtctagttaattttgttgattaattctaactttgac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9642110 |
gcaaacttaacatatatatgaaatgtctagttaattttgttgattaattctaactttgac |
9642051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University