View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0934_low_31 (Length: 297)

Name: NF0934_low_31
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0934_low_31
NF0934_low_31
[»] chr3 (1 HSPs)
chr3 (157-223)||(9016241-9016307)


Alignment Details
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 157 - 223
Target Start/End: Original strand, 9016241 - 9016307
Alignment:
157 gttaaacaagacacgttagggttatgattaaaatgtaatcctatgacaaattacatactttggcttt 223  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
9016241 gttaaacaagacacgttagggttatgactaaaatgtaatcctatgacaaattacatactttggcttt 9016307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University