View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_low_34 (Length: 288)
Name: NF0934_low_34
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 84 - 191
Target Start/End: Complemental strand, 37134494 - 37134388
Alignment:
| Q |
84 |
ataattctagtgacagacgaaaccttttacatgcatacacaataaactcaggaaacattgaaaataataaaaaagattaacacccacatgtagaatggga |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37134494 |
ataattctagtgacagacgaaaccttttacatgcatacacaataaactcaggaaacattgaaaataata-aaaagattaacacccacatgtagaatggga |
37134396 |
T |
|
| Q |
184 |
taacaaga |
191 |
Q |
| |
|
|||||||| |
|
|
| T |
37134395 |
taacaaga |
37134388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University