View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_low_39 (Length: 282)
Name: NF0934_low_39
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 52 - 246
Target Start/End: Complemental strand, 41507497 - 41507302
Alignment:
| Q |
52 |
aagtattgcatcattaagttatgtaagttagtttcaccattaaattaataagttttaccattaattaaagtaaaatatgatataatttatcgatttatta |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41507497 |
aagtattgcatcattaagttatgtaagttagtttcaccattaaattaataagttttaccattaatttaagtaaaatatgatataatttatcgatttatta |
41507398 |
T |
|
| Q |
152 |
gt-nnnnnnntattttgtatggtccaagatcttttacttatgtatatttgataaagttttttaatttggtcgttgcttctagacttcatatcagtc |
246 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41507397 |
gtaaaaaaaatattttgtatggtccaagatcttttacttatgtatatttgataaagttttttaatttggtcgttgcttctagactttttatcagtc |
41507302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 68
Target Start/End: Complemental strand, 41507541 - 41507511
Alignment:
| Q |
38 |
agtgagatgaatataagtattgcatcattaa |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41507541 |
agtgagatgaatataagtattgcatcattaa |
41507511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University