View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_low_40 (Length: 281)
Name: NF0934_low_40
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0934_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 47 - 221
Target Start/End: Original strand, 47052225 - 47052399
Alignment:
Q |
47 |
aaagaatcgataattgtgccctgaaagttcttgataaactgatcaactctctctacaaaaacacccgcactcttatacaaattgacttgtttatcctccg |
146 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
T |
47052225 |
aaagaatcgataattgtgccctgaaagttcttgataaactgatcaactctctctacaaaaacacccgcacacttatccaaattgacttgtttatcctccg |
47052324 |
T |
 |
Q |
147 |
tatcagaagcattaacgagatagccggattgtagcagatcgtgttcagtggttccaagcatgaagatgtcaaaga |
221 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47052325 |
tatcagaagcattaacgagatagccggattgtagcagatcgtgttcagtggttccaagcatgaagatgtcaaaga |
47052399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 213
Target Start/End: Original strand, 48108568 - 48108618
Alignment:
Q |
163 |
gagatagccggattgtagcagatcgtgttcagtggttccaagcatgaagat |
213 |
Q |
|
|
|||||| ||||||||||||||||||| ||| || |||||||||||||||| |
|
|
T |
48108568 |
gagatacccggattgtagcagatcgtcctcattgcttccaagcatgaagat |
48108618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University