View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_low_41 (Length: 277)
Name: NF0934_low_41
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 14 - 217
Target Start/End: Original strand, 46996827 - 46997032
Alignment:
| Q |
14 |
atataagaattatacttattcgatttcgttttattttgactcacttataacgttgtgagttcaacctctacggtcaagttaatgatcnnnnnnnnn---- |
109 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||||| |||||||| |||||||| |
|
|
| T |
46996827 |
atataagaattatacttattctatttcgtttcattttgactcacttataaggttgtgagttcaacctctgcggtcaagataatgatcttttctttttttt |
46996926 |
T |
 |
| Q |
110 |
-aatggc--gataatgatctctctcatgtgagtgttttataaattatcgctctctaagctttgagatttgctcttatcatgatgagtttcggatgccaat |
206 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
46996927 |
gaatggccagataatgatctc--tcatgtgagtgttttataaattatcgctctctaagctttgagatttgc---tatcctgatgagtttcggatgccaat |
46997021 |
T |
 |
| Q |
207 |
tcacttaacct |
217 |
Q |
| |
|
|||| |||||| |
|
|
| T |
46997022 |
tcacctaacct |
46997032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University