View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_low_43 (Length: 275)
Name: NF0934_low_43
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 56 - 240
Target Start/End: Complemental strand, 30386019 - 30385835
Alignment:
| Q |
56 |
ttcagatttaaaattttctggttgttgatacaggaaagtgaacatttagttatgtgtatcttttcgttagggttgatataatggaagagtgtgaaacagt |
155 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30386019 |
ttcaaatttaaatttttctggttgttgatacaggaaagtgaacatttagttatgtgtatcttttcgttagggttgatataatggaagagtgtgaaacagt |
30385920 |
T |
|
| Q |
156 |
atgctatcgttggatctacaatgaatgctgaatttgtgggatgctttgaggccacactttagacaaattgactgggaaacttcat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30385919 |
atgctatcgttggatctacaatgaatgctgaatttgtgggatgctttgaggccacactttagacaaattgactgggaaacttcat |
30385835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University