View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_low_48 (Length: 251)
Name: NF0934_low_48
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 11 - 226
Target Start/End: Original strand, 3827717 - 3827932
Alignment:
| Q |
11 |
ttatactttattagtttggtttcttaaaatgtttttcgattggcttcttnnnnnnnttgaagaatttgaataatcctgtaaaatcatactgatgtaatca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
3827717 |
ttatactttattagtttggtttcttaaaatgtttctcgattggcttcttaaaaaaattgaagaatttgaattatcctgtaagatcatactgatgtaatca |
3827816 |
T |
|
| Q |
111 |
taaaattctctcatccaattattttaagtaacacttgcacaaagctaattaaggccccagcctttgttttcattcctaagctgagcaactcagtctatgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3827817 |
taaaattctctcatccaattattttaagtaacacttgcacaaagctaattaaggccccagcctttgttttcattcctaagctgagcaactcagtctatgt |
3827916 |
T |
|
| Q |
211 |
ctagtttatcaataaa |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3827917 |
ctagtttatcaataaa |
3827932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University