View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0934_low_51 (Length: 230)
Name: NF0934_low_51
Description: NF0934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0934_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 25 - 132
Target Start/End: Original strand, 39930879 - 39930986
Alignment:
| Q |
25 |
gtaaatatgagtcacactgttagtctatcatgacaaaacaaaatgctagcatatatgcaacataatttggatcgagtgttaaactttaccagcaataaaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39930879 |
gtaaatatgagtcacactgttagtctatcatgacaaaacaaaatgctagcatatatgcaacataatttggatcgagtgttaaactttaccagcaataaaa |
39930978 |
T |
 |
| Q |
125 |
tacaagaa |
132 |
Q |
| |
|
|||||||| |
|
|
| T |
39930979 |
tacaagaa |
39930986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University