View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0935_high_6 (Length: 273)
Name: NF0935_high_6
Description: NF0935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0935_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 129 - 241
Target Start/End: Complemental strand, 13312253 - 13312141
Alignment:
| Q |
129 |
ctgcatgttgtcaccatattcacagaaccatcagttatatatcccagttgggaaaatgacaatgacagttgataatctgtcttgtctgtggcatctacca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| || |
|
|
| T |
13312253 |
ctgcatgttgtcaccatattcacagaaccatcagttatatatcccagttgggaaaatgacaatgacagttgataatgtgtctcgtctgtggcatctatca |
13312154 |
T |
 |
| Q |
229 |
atccatgtctgtg |
241 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13312153 |
atccatgtctgtg |
13312141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 45 - 134
Target Start/End: Complemental strand, 13312407 - 13312318
Alignment:
| Q |
45 |
atcatcattataaagactctaaaagaaggatggttcacaaacgcaattacaaatagtgcacacgagctattgctaatttgatcactgcat |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
13312407 |
atcatcattataaagactctaaaagaaggatggttcacaaacgcaattacaaatagtgcacacaagctattactaatttgatcactgcat |
13312318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University