View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0935_low_11 (Length: 314)
Name: NF0935_low_11
Description: NF0935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0935_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 110 - 260
Target Start/End: Complemental strand, 4469977 - 4469827
Alignment:
| Q |
110 |
aatagtgattgattgccatgatgtttaaattcaaagtttttatagttatcagaataatataaaaaattattgtgtttatgttcctaaaaataacatatta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4469977 |
aatagtgattgattgccatgatgtttaatttcaaagtttttatagttatcagaataatataaaaaattattgtgtttatgttcctaaaaataacatctta |
4469878 |
T |
|
| Q |
210 |
tgaacattattattctgataaatacaagtagttgatttatgttgttgaggg |
260 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4469877 |
tgtacattattattctgataaatacaagtagttgatttatgttgttgaggg |
4469827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University