View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0935_low_15 (Length: 261)
Name: NF0935_low_15
Description: NF0935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0935_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 32166692 - 32166460
Alignment:
| Q |
1 |
aagatattgagaccacgttaaataacccaagccaaacaactttgtggtcgggttctatttttgttataagatatatcaagtgatctctatggttaaagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32166692 |
aagatattgagaccacgttaaataacccaagccaaacaactttgtggtcgggttctatttttgttataagatatatcaagtgatctctatggttaaagtc |
32166593 |
T |
 |
| Q |
101 |
ttatggacatgtaagttaggagaaataaaaatattattgttcctgactggatcaatgtccagtccatcacggattaacaaaaaatggatgcaatgttgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32166592 |
ttatggacatgtaagttaggagaaataaaaatattattgttcctgactggatcaatgtccagtccatcacggattaacataaaatggatgcaatgttgtg |
32166493 |
T |
 |
| Q |
201 |
ttttgctgaggcagctttttggctattgaaatt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32166492 |
ttttgctgaggcagctttttggctattgaaatt |
32166460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University