View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0935_low_8 (Length: 378)
Name: NF0935_low_8
Description: NF0935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0935_low_8 |
 |  |
|
[»] scaffold0725 (2 HSPs) |
 |  |  |
|
[»] scaffold0039 (1 HSPs) |
 |  |  |
|
[»] scaffold0014 (2 HSPs) |
 |  |  |
|
[»] scaffold0095 (1 HSPs) |
 |  |  |
|
[»] scaffold0250 (1 HSPs) |
 |  |  |
|
[»] scaffold0007 (1 HSPs) |
 |  |  |
|
[»] scaffold0246 (1 HSPs) |
 |  |  |
|
[»] scaffold0136 (1 HSPs) |
 |  |  |
|
[»] scaffold1797 (1 HSPs) |
 |  |  |
|
[»] scaffold0176 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 3e-39; HSPs: 38)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 35 - 137
Target Start/End: Original strand, 27118431 - 27118533
Alignment:
Q |
35 |
catattgtggattcttaaaattgtaaaacggattatgttgttttcacatagtgatggggtttgggaagtgcattagaaatgataaatggagttaattaat |
134 |
Q |
|
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
T |
27118431 |
catattgtggattcttaaccttgtaaaacggattattttgttttcacatagtgatggggtttgggaagtgcattagaaataataaagggagttaattaat |
27118530 |
T |
 |
Q |
135 |
ttg |
137 |
Q |
|
|
||| |
|
|
T |
27118531 |
ttg |
27118533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 154 - 303
Target Start/End: Complemental strand, 9751714 - 9751566
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| ||| |||| ||||||||||||| ||||||||||||||| || || | |
|
|
T |
9751714 |
ccctgtaatataggtcacttttggttttgccccctgtaaattttttttttt-gattcggtccttgtaaaatttttttgttttggaaaacccccctagacc |
9751616 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
T |
9751615 |
agctgactgtgcatttttgctgatgtggcatgttgtgtcagcctttttgg |
9751566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 154 - 303
Target Start/End: Original strand, 28819555 - 28819704
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| ||| |||| ||||||||||||| ||||||||||||||| || || | |
|
|
T |
28819555 |
ccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaaatttggattcggtccttgtaaaaaaattttgttttggaaaacccccctagacc |
28819654 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||||||||||||||||||| || |||||| | ||||||||||||||| |
|
|
T |
28819655 |
agctgactgtgcatttttgctgttggggcatgctacgtcaccctttttgg |
28819704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 154 - 303
Target Start/End: Complemental strand, 35600576 - 35600427
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||||| |||||| |||||||| || || | |
|
|
T |
35600576 |
ccctgtaatataggtcacttttggttttgccccttgtaaaaaaaaatttttagatttggtccttgtaaaatttttttgttttgaaaaacccccctagacc |
35600477 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||| ||||||||||||||||||||||||||| | ||||||| ||||||| |
|
|
T |
35600476 |
agctaactgtgcatttttgctgatgtggcatgctccgtcaccttttttgg |
35600427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 231 - 300
Target Start/End: Original strand, 9750543 - 9750612
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
9750543 |
gttttggaaaacccccctagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcaccttttt |
9750612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 154 - 303
Target Start/End: Complemental strand, 28820593 - 28820445
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||| ||||| ||||||| || |||| ||||||||||||| ||||||||||||||| || || | |
|
|
T |
28820593 |
ccctgtaatataggtcacttttgattttgccccctgtaaaaaaaaaaaattggattcggtccttgtaaaaattttttgttttggaaaacccc-ctagacc |
28820495 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
28820494 |
agctgacggtgcatttttgctgatgtggcatgttgtgtcaccctttttgg |
28820445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 154 - 303
Target Start/End: Original strand, 35599332 - 35599481
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||| ||||||||||||||| || || | |
|
|
T |
35599332 |
ccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaaatttagattcggtccttgtaatttttttttgttttggaaaacccccctagacc |
35599431 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||||||||||||||| ||||||||||||| | ||||||| ||||||| |
|
|
T |
35599432 |
agctgactgtgcattttttctgatgtggcatgctccgtcaccttttttgg |
35599481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 19600069 - 19600141
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| || || |||| ||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
T |
19600069 |
gttttggaaaacccccctagaccagccgactgtgcatttttgctaatgtggcatgttgcttcaccctttttgg |
19600141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 154 - 300
Target Start/End: Complemental strand, 19601304 - 19601159
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||||| ||| |||| ||||||||||||| ||||||||||||||| || || | |
|
|
T |
19601304 |
ccctgtaatataggtcacttttggttttgcatcctgtaaaaaaaaaattttggattcggtccttgtaaaatttttttgttttggaaaacccc-ctagacc |
19601206 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||||||| |||||||||||| ||||||||| |||| |
|
|
T |
19601205 |
agctgactgtgcatttttgttgatgtggcatgatgcgtcaccttttt |
19601159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 253 - 300
Target Start/End: Complemental strand, 32145871 - 32145824
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
32145871 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcaccttttt |
32145824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 4602945 - 4602896
Alignment:
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||| | ||||||| |
|
|
T |
4602945 |
agctgactgtgcatttttgctgatgtggcatgttgcatcatcttttttgg |
4602896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 254 - 295
Target Start/End: Complemental strand, 11890038 - 11889997
Alignment:
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacc |
295 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
11890038 |
agctgactgtgcatttttgctgatgtggcatgttgtgtcacc |
11889997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 11890150 - 11890101
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||| ||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
T |
11890150 |
aataggcctttacccctgtaatataggtcacttttggttttgccccctgt |
11890101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 231 - 294
Target Start/End: Complemental strand, 29321265 - 29321202
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcac |
294 |
Q |
|
|
|||||||||||| || || || ||||||| ||||||||| ||||||||||||||| |||||||| |
|
|
T |
29321265 |
gttttggaaaactcccctagaccagctgaatgtgcatttatgctgatgtggcatgctgcgtcac |
29321202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 253 - 300
Target Start/End: Original strand, 32144980 - 32145027
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||| |||| |
|
|
T |
32144980 |
cagctgactgtgcatttttgctgatgtggcatgctgtgtcaccttttt |
32145027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 255 - 301
Target Start/End: Original strand, 15395662 - 15395708
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacccttttt |
301 |
Q |
|
|
||||||||||||||||||||||||||||||| || |||||| ||||| |
|
|
T |
15395662 |
gctgactgtgcatttttgctgatgtggcatgctgtgtcacctttttt |
15395708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 136 - 190
Target Start/End: Complemental strand, 21149157 - 21149103
Alignment:
Q |
136 |
tggtcaataggtctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||| |||||||||||| ||||||||||||||||| |||||||||| | |||||| |
|
|
T |
21149157 |
tggttaataggtctttacccctgtaatataggtcatttttggttttcttccctgt |
21149103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 157 - 190
Target Start/End: Original strand, 9750470 - 9750503
Alignment:
Q |
157 |
tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
9750470 |
tgtaatataggtcacttttggttttgtcccctgt |
9750503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 188
Target Start/End: Original strand, 10011623 - 10011671
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccct |
188 |
Q |
|
|
|||||||||||||||| ||||||||||| |||||||||||||| ||||| |
|
|
T |
10011623 |
aataggtctttatcccgtgtaatataggacacttttggttttgccccct |
10011671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 188
Target Start/End: Complemental strand, 10012858 - 10012810
Alignment:
Q |
141 |
aataggtctttatcc-ctgtaatataggtcacttttggttttgtcccct |
188 |
Q |
|
|
||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
T |
10012858 |
aataggtctttatcctctgtaatatagggtacttttggttttgtcccct |
10012810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 29320240 - 29320280
Alignment:
Q |
263 |
tgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||||||||||| |||||| |||||||||| |
|
|
T |
29320240 |
tgcatttttgctgatgtggcatgctgcgtcgccctttttgg |
29320280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 29321360 - 29321309
Alignment:
Q |
141 |
aataggtctttatccc--tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
T |
29321360 |
aataggtctttatcctcatgtaatataggtcatttttggttttgtcccctgt |
29321309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 231 - 294
Target Start/End: Original strand, 4602265 - 4602328
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcac |
294 |
Q |
|
|
|||||||||||||| || | ||| |||||||||||||||||||||||| ||||||| ||||| |
|
|
T |
4602265 |
gttttggaaaaccctcctaggccagttgactgtgcatttttgctgatgtgacatgttgtgtcac |
4602328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 141 - 187
Target Start/End: Original strand, 15615108 - 15615155
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccc |
187 |
Q |
|
|
|||||||||||| ||| ||||||||||| ||||||||||||||||||| |
|
|
T |
15615108 |
aataggtctttaccccctgtaatatagggcacttttggttttgtcccc |
15615155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 253 - 283
Target Start/End: Original strand, 5699872 - 5699902
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
5699872 |
cagctgactgtgcatttttgctgatgtggca |
5699902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 15061875 - 15061825
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||||||||| ||||||| |
|
|
T |
15061875 |
aataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
15061825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 154 - 188
Target Start/End: Original strand, 19599990 - 19600024
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccct |
188 |
Q |
|
|
||||||||||||||||||||||||||||| ||||| |
|
|
T |
19599990 |
ccctgtaatataggtcacttttggttttgccccct |
19600024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 254 - 300
Target Start/End: Complemental strand, 23932394 - 23932348
Alignment:
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||| |||| |
|
|
T |
23932394 |
agctgactgtgcattttcgctgatgtggcatgctgagtcaccgtttt |
23932348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 129 - 190
Target Start/End: Complemental strand, 21776972 - 21776908
Alignment:
Q |
129 |
attaatttgg-tcaataggtctttatccct--gtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||| | |||||||||||| |||| |||||||||| |||||||||||||| ||||||| |
|
|
T |
21776972 |
attaatttgggttaataggtctttacccctctgtaatatagggcacttttggttttgccccctgt |
21776908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 181
Target Start/End: Complemental strand, 23932507 - 23932466
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||||||| || |||||||||||||||||||||| |
|
|
T |
23932507 |
aataggtctttatcccctgcaatataggtcacttttggtttt |
23932466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 231 - 283
Target Start/End: Complemental strand, 11466662 - 11466610
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
||||||||| |||| || | ||||||||||||||||||| |||||||||||| |
|
|
T |
11466662 |
gttttggaataccctcctaggtcagctgactgtgcattttcgctgatgtggca |
11466610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 11956159 - 11956195
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
11956159 |
ccctgtaatatagggcacttttggttttggcccctgt |
11956195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 11957686 - 11957650
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
11957686 |
ccctgtaatatagggcacttttggttttgccccctgt |
11957650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 15060183 - 15060219
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
15060183 |
ccctgtaatataggacacttttggttttgccccctgt |
15060219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 15616537 - 15616501
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
15616537 |
ccctgtaatataggacacttttggttttgccccctgt |
15616501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 127 - 182
Target Start/End: Original strand, 30796570 - 30796626
Alignment:
Q |
127 |
taattaatttggtcaataggtctttatccc-tgtaatataggtcacttttggttttg |
182 |
Q |
|
|
||||||||| ||| |||||||||||| ||| | ||||||||| |||||||||||||| |
|
|
T |
30796570 |
taattaattgggttaataggtctttaccccctataatatagggcacttttggttttg |
30796626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 41064164 - 41064200
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
41064164 |
ccctgtaatatagggcacttttggttttgccccctgt |
41064200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 41065694 - 41065658
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
41065694 |
ccctgtaatatagggcacttttggttttggcccctgt |
41065658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 61; Significance: 4e-26; HSPs: 33)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 141 - 294
Target Start/End: Complemental strand, 14328698 - 14328544
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaa |
239 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||||||| ||||||| |||||||| | ||||||||||| ||||||||| |
|
|
T |
14328698 |
aataggtctttaccccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaactttagattcgatccttgtaaaatttttttgttttggaa |
14328599 |
T |
 |
Q |
240 |
aacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcac |
294 |
Q |
|
|
|||||| || || ||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
14328598 |
aacccccctagaccagctgactgtgcatttttgctgatgtggcatgttccgtcac |
14328544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 141 - 294
Target Start/End: Complemental strand, 14421708 - 14421554
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaa |
239 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||||||| ||||||| |||||||| | ||||||||||| ||||||||| |
|
|
T |
14421708 |
aataggtctttaccccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaactttagattcgatccttgtaaaatttttttgttttggaa |
14421609 |
T |
 |
Q |
240 |
aacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcac |
294 |
Q |
|
|
|||||| || || ||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
14421608 |
aacccccctagaccagctgactgtgcatttttgctgatgtggcatgttccgtcac |
14421554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 3062285 - 3062357
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| || || |||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
T |
3062285 |
gttttggaaaacccccctagaccagctgactgtgcatttttgctgatgtggcatgttgtgtcacccattttgg |
3062357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 141 - 300
Target Start/End: Complemental strand, 3063535 - 3063376
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaa |
239 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||||||| ||| || || |||| ||||||||||||| ||||||||| |
|
|
T |
3063535 |
aataggtctttaccccctgtaatataggtcacttttggttttgccccttgaaaaaaaaaaaaattggattcggtccttgtaaaatttttttgttttggaa |
3063436 |
T |
 |
Q |
240 |
aacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||| || || ||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
T |
3063435 |
aacccc-ctagaccagctgactgtgcatttttgctgatgtggcatgctgcgtcaccttttt |
3063376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 231 - 303
Target Start/End: Complemental strand, 26470216 - 26470145
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| || || ||| ||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
T |
26470216 |
gttttggaaaacccc-ctagaccagttgactgtgcatttttgctgatgtggcatgctgcgtcaccttttttgg |
26470145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 231 - 303
Target Start/End: Complemental strand, 20754534 - 20754462
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||||||||||| || || ||||||||||| ||||||||||||| || |||||||||||||| ||||||| |
|
|
T |
20754534 |
gttttggaaaacccacctagaccagctgactgtacatttttgctgatatgacatgttgcgtcaccttttttgg |
20754462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 26469102 - 26469172
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| || || || ||||||| ||||||||||||||||||||| ||||||||| ||||||| |
|
|
T |
26469102 |
gttttggaaaacccccctagaccaactgactg--catttttgctgatgtggcatgctgcgtcaccttttttgg |
26469172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 253 - 293
Target Start/End: Original strand, 20753400 - 20753440
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtca |
293 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
20753400 |
cagctgactgtgcatttttgctgatgtggcatgctgcgtca |
20753440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 54812 - 54861
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
T |
54812 |
aataggtctttcctcctgtaatataggacacttttggttttgtcccctgt |
54861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 231 - 300
Target Start/End: Original strand, 3119416 - 3119485
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || | |||||||||||||||||| |||||||||||| | || |||||| |||| |
|
|
T |
3119416 |
gttttggaaaacccccctaggccagctgactgtgcattttcgctgatgtggcacgctgagtcaccatttt |
3119485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 154 - 285
Target Start/End: Original strand, 14327388 - 14327518
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
|||||||||||| |||||||||||||||| ||||||| ||| |||| |||| |||||||| |||||||||||||||| | || | |
|
|
T |
14327388 |
ccctgtaatatacgtcacttttggttttgccccctgtaaaaaaaaaactttcgattcggtctttgtaaaatttttttgttttggaaaacccct-tagacc |
14327486 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatg |
285 |
Q |
|
|
|||||||||| |||||||||||||||||||| |
|
|
T |
14327487 |
agctgactgtatatttttgctgatgtggcatg |
14327518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 154 - 285
Target Start/End: Original strand, 14420398 - 14420528
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
|||||||||||| |||||||||||||||| ||||||| ||| |||| |||| |||||||| |||||||||||||||| | || | |
|
|
T |
14420398 |
ccctgtaatatacgtcacttttggttttgccccctgtaaaaaaaaaactttcgattcggtctttgtaaaatttttttgttttggaaaacccct-tagacc |
14420496 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatg |
285 |
Q |
|
|
|||||||||| |||||||||||||||||||| |
|
|
T |
14420497 |
agctgactgtatatttttgctgatgtggcatg |
14420528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 22056478 - 22056538
Alignment:
Q |
132 |
aatttggtcaataggtcttta--tccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||| ||| |||||||||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
22056478 |
aattgggttaataggtctttaactccctgtaatatagggcacttttggttttgccccctgt |
22056538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 231 - 300
Target Start/End: Original strand, 30408683 - 30408751
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || | |||||||||||||||||| |||||||||||||| || |||||| |||| |
|
|
T |
30408683 |
gttttggaaaacccc-ctaggccagctgactgtgcattttcgctgatgtggcatgctgagtcaccatttt |
30408751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 231 - 283
Target Start/End: Original strand, 18983013 - 18983065
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
||||||||||||||| || | |||||||||||||||||| |||||||||||| |
|
|
T |
18983013 |
gttttggaaaacccccctaggccagctgactgtgcattttcgctgatgtggca |
18983065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 131 - 276
Target Start/End: Complemental strand, 23270271 - 23270126
Alignment:
Q |
131 |
taatttggtcaataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnn |
229 |
Q |
|
|
||||| ||| |||||||||||| ||| | |||||||||||||||||| |||||||| |||| ||| |||| ||||||||||||| |
|
|
T |
23270271 |
taattgggttaataggtctttaccccctttaatataggtcacttttgattttgtcctctgtaaaattattttttt-gattcggtccttgtaaaaaaaatt |
23270173 |
T |
 |
Q |
230 |
ngttttggaaaacccctctggatcagctgactgtgcatttttgctga |
276 |
Q |
|
|
||||| ||||||||| || || |||||||||||||||||||||||| |
|
|
T |
23270172 |
tgttttcgaaaacccccctagaccagctgactgtgcatttttgctga |
23270126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 300
Target Start/End: Original strand, 32614268 - 32614336
Alignment:
Q |
232 |
ttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||| || | ||||||||||||||||||| |||||||| |||| ||| ||||| |||| |
|
|
T |
32614268 |
ttttggaaaacccccctaggccagctgactgtgcatttttactgatgtgacatgatgcctcaccttttt |
32614336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 232 - 283
Target Start/End: Complemental strand, 18983964 - 18983914
Alignment:
Q |
232 |
ttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
|||||||||||||| || | ||||||||||||||||||| |||||||||||| |
|
|
T |
18983964 |
ttttggaaaacccc-ctaggtcagctgactgtgcattttcgctgatgtggca |
18983914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 261 - 300
Target Start/End: Original strand, 25385465 - 25385504
Alignment:
Q |
261 |
tgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||||| |||||||||||||||||| |||| |
|
|
T |
25385465 |
tgtgcatttttgctgaggtggcatgttgcgtcaccttttt |
25385504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 56164 - 56114
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||| ||||||||||||| |
|
|
T |
56164 |
aataggtctttaccccctgtaatatagggcacttttgattttgtcccctgt |
56114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 312 - 370
Target Start/End: Original strand, 26470162 - 26470220
Alignment:
Q |
312 |
gcatgccacaacagcaaaaatgcacagtccacttgtccaaggggttttcccacacaaaa |
370 |
Q |
|
|
|||||||||| |||||||||||||||||| ||| ||| | |||||||||| | |||||| |
|
|
T |
26470162 |
gcatgccacatcagcaaaaatgcacagtcaactggtctagggggttttccaaaacaaaa |
26470220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 255 - 301
Target Start/End: Complemental strand, 26644629 - 26644583
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacccttttt |
301 |
Q |
|
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
T |
26644629 |
gctgactgtgcatttttgctgatgtggattgttgggtcacctttttt |
26644583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 255 - 301
Target Start/End: Complemental strand, 26750595 - 26750549
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacccttttt |
301 |
Q |
|
|
||||||||||||||||||||||||||| ||||| |||||| ||||| |
|
|
T |
26750595 |
gctgactgtgcatttttgctgatgtggattgttgggtcacctttttt |
26750549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 181
Target Start/End: Original strand, 5953162 - 5953207
Alignment:
Q |
136 |
tggtcaataggtctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||| |||||||||||| ||||||||||||||||| || ||||||| |
|
|
T |
5953162 |
tggttaataggtctttacccctgtaatataggtcatttctggtttt |
5953207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 181
Target Start/End: Original strand, 7922322 - 7922363
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||||||| |||||||||||||| |||||||||| |
|
|
T |
7922322 |
aataggtctttatcccctgtaatataggtcatttttggtttt |
7922363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 12239862 - 12239793
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || | ||||||||||||||||| |||||||||||| | || |||||| |||| |
|
|
T |
12239862 |
gttttggaaaacccccctaggccagctgactgtgcatttccgctgatgtggcacggtgagtcaccatttt |
12239793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 181
Target Start/End: Original strand, 26644099 - 26644132
Alignment:
Q |
148 |
ctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
||||| |||||||||||||||||||||||||||| |
|
|
T |
26644099 |
ctttacccctgtaatataggtcacttttggtttt |
26644132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 181
Target Start/End: Original strand, 26750065 - 26750098
Alignment:
Q |
148 |
ctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
||||| |||||||||||||||||||||||||||| |
|
|
T |
26750065 |
ctttacccctgtaatataggtcacttttggtttt |
26750098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 181
Target Start/End: Original strand, 17441407 - 17441447
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||| ||||||||||||||||| ||| |||||| |
|
|
T |
17441407 |
aataggtctttacccctgtaatataggtcattttcggtttt |
17441447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 22058316 - 22058280
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
22058316 |
ccctgtaatatagggcacttttggttttgccccctgt |
22058280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 24234349 - 24234385
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
24234349 |
ccctgtaatataggacacttttggttttgccccctgt |
24234385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 24235683 - 24235632
Alignment:
Q |
141 |
aataggtctttatccct--gtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| |||| |||||||||| |||||||||||||| ||||||| |
|
|
T |
24235683 |
aataggtctttacccctctgtaatatagggcacttttggttttgccccctgt |
24235632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 231 - 283
Target Start/End: Complemental strand, 30409630 - 30409579
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
||||||||||||||| || | |||||||||||||||||| |||||||||||| |
|
|
T |
30409630 |
gttttggaaaacccc-ctaggccagctgactgtgcattttcgctgatgtggca |
30409579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 2e-25; HSPs: 37)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 154 - 303
Target Start/End: Complemental strand, 34027232 - 34027084
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| ||| |||| ||||||||||||| ||||||||||||||| || || | |
|
|
T |
34027232 |
ccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaacttttcgattcggtccttgtaaaatttttttgttttggaaaacccc-ctagacc |
34027134 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
T |
34027133 |
agctgactgtgcatttttgctgatgtggcatgttgtgtcagcctttttgg |
34027084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 206 - 303
Target Start/End: Original strand, 51162146 - 51162243
Alignment:
Q |
206 |
gatttggtccttgtaaaannnnnnngttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||||||||||||||| ||||||||||||||| || || || ||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
T |
51162146 |
gatttggtccttgtaaaaaaaatttgttttggaaaacccccctagaccaactgactgtgcatttttgttgatgtggcatgttgcgtcaccttttttgg |
51162243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 141 - 300
Target Start/End: Original strand, 550678 - 550838
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaa |
239 |
Q |
|
|
|||||||||||| ||| |||||||||||||| |||| |||||| ||| ||| ||| |||| ||||||||||||| ||||||||| |
|
|
T |
550678 |
aataggtctttaccccctgtaatataggtcatttttagttttgccccttgtaaaattttttttttggattcggtccttgtaaaatttttttgttttggaa |
550777 |
T |
 |
Q |
240 |
aacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||| || || ||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
T |
550778 |
aacccccctagaccagctgactgtgcatttttgctgatgtggcatgctgcgtcaccttttt |
550838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 231 - 303
Target Start/End: Complemental strand, 7515750 - 7515678
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| || || |||| | ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
7515750 |
gttttggaaaacccccctagactagctaattgtgcatttttgctgatgtggcatgctgcgtcaccctttttgg |
7515678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 300
Target Start/End: Original strand, 34026011 - 34026079
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || || ||| |||||||| ||||||||||||||| |||||||||||||| |||| |
|
|
T |
34026011 |
gttttggaaaacccc-ctagaccagttgactgtgtatttttgctgatgtgacatgttgcgtcaccttttt |
34026079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 44071262 - 44071193
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || | || |||||||||||||||| ||||||||||||| ||||||||| |||| |
|
|
T |
44071262 |
gttttggaaaacccccctaaaccaactgactgtgcatttttactgatgtggcatgctgcgtcaccttttt |
44071193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 300
Target Start/End: Original strand, 47765348 - 47765417
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||||||| | |||||||||||||||||| |||||||||||| | || |||||| |||| |
|
|
T |
47765348 |
gttttggaaaacccctctaggccagctgactgtgcattttcgctgatgtggcacgctgagtcaccatttt |
47765417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 48029529 - 48029578
Alignment:
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
T |
48029529 |
agctgactgtgcatttttgctgatgaggcatgttgtgtcaccttttttgg |
48029578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 44070179 - 44070250
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| || || |||||||||||||||||||||||||||| |||| ||||||| ||||||| |
|
|
T |
44070179 |
gttttggaaaacccc-ctagaccagctgactgtgcatttttgctgatgtgacatgcaacgtcaccttttttgg |
44070250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 252 - 291
Target Start/End: Complemental strand, 12760689 - 12760650
Alignment:
Q |
252 |
tcagctgactgtgcatttttgctgatgtggcatgttgcgt |
291 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
12760689 |
tcagctgactgtgcattttcgctgatgtggcatgttgcgt |
12760650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 231 - 293
Target Start/End: Original strand, 937751 - 937813
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtca |
293 |
Q |
|
|
||||||||||||||| || | ||||||||||| |||||||||||||||| |||||| ||||| |
|
|
T |
937751 |
gttttggaaaaccccactaggccagctgactgtacatttttgctgatgtgacatgttccgtca |
937813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 239 - 301
Target Start/End: Original strand, 41331874 - 41331936
Alignment:
Q |
239 |
aaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcacccttttt |
301 |
Q |
|
|
||||||| || ||||||||||||||||||||| |||||||||||| | || |||||| ||||| |
|
|
T |
41331874 |
aaacccccctagatcagctgactgtgcattttcgctgatgtggcacgctgagtcacctttttt |
41331936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 137 - 181
Target Start/End: Original strand, 35539605 - 35539650
Alignment:
Q |
137 |
ggtcaataggtctttatccc-tgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
T |
35539605 |
ggtcaataggtctttatcccctgtaatataggtcatttttggtttt |
35539650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 44199905 - 44199856
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||| |||||||| ||||||||| |||||||||||||||| ||||||| |
|
|
T |
44199905 |
aataggcctttatccttgtaatatacgtcacttttggttttgccccctgt |
44199856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 231 - 303
Target Start/End: Complemental strand, 54054345 - 54054273
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||| | || | ||||||||||||||||||| ||||||||||||| || ||||| ||||||| |
|
|
T |
54054345 |
gttttggaaaacctccctaggccagctgactgtgcatttttactgatgtggcatgatgtctcaccttttttgg |
54054273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 255 - 302
Target Start/End: Complemental strand, 39865917 - 39865870
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttg |
302 |
Q |
|
|
|||||||||||||||||||||||||| |||| || |||||| |||||| |
|
|
T |
39865917 |
gctgactgtgcatttttgctgatgtgacatgatgtgtcaccttttttg |
39865870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 253 - 284
Target Start/End: Complemental strand, 48030215 - 48030184
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcat |
284 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
48030215 |
cagctgactgtgcatttttgctgatgtggcat |
48030184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 253 - 300
Target Start/End: Original strand, 54053687 - 54053734
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||| |||||||||||||||||||| ||| ||||| |||| |
|
|
T |
54053687 |
cagctgactgtgtatttttgctgatgtggcatgatgcatcaccttttt |
54053734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 156 - 190
Target Start/End: Complemental strand, 9410318 - 9410284
Alignment:
Q |
156 |
ctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| |||||||||||||||||||||| |
|
|
T |
9410318 |
ctgtaatatagggcacttttggttttgtcccctgt |
9410284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 21994332 - 21994382
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||| ||||||||||||| |
|
|
T |
21994332 |
aataggtctttaccccctgtaatataggacacttttgattttgtcccctgt |
21994382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 250 - 300
Target Start/End: Original strand, 43860624 - 43860674
Alignment:
Q |
250 |
gatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||||||||| |||||||||||| | || |||||||||| |
|
|
T |
43860624 |
gatcagctgactgtgcattttcgctgatgtggcacgctgattcaccctttt |
43860674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 43860965 - 43860915
Alignment:
Q |
141 |
aataggtctttatc-cctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| | ||||||||||||| |||||||||||||||| ||||| |
|
|
T |
43860965 |
aataggtctttacctcctgtaatatagggcacttttggttttgtctcctgt |
43860915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 50881474 - 50881424
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||||||||| ||||||| |
|
|
T |
50881474 |
aataggtctttaccccctgtaatataggccacttttggttttgccccctgt |
50881424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 54554388 - 54554438
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||||||||| ||||||| |
|
|
T |
54554388 |
aataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
54554438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 170
Target Start/End: Original strand, 1386039 - 1386068
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtca |
170 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
1386039 |
aataggtctttatccctgtaatataggtca |
1386068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 181
Target Start/End: Original strand, 41331774 - 41331815
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||||||| || |||||||||||||||||||||| |
|
|
T |
41331774 |
aataggtctttatcccctgcaatataggtcacttttggtttt |
41331815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 53231779 - 53231828
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||| |||||| ||||||||||||||||| |||||||||| ||| |||| |
|
|
T |
53231779 |
aatagatctttacccctgtaatataggtcatttttggttttttcctctgt |
53231828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 9136442 - 9136406
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||| ||||||||||||||| ||||||| |
|
|
T |
9136442 |
ccctgtaatatagatcacttttggttttgccccctgt |
9136406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 256 - 300
Target Start/End: Complemental strand, 12352395 - 12352351
Alignment:
Q |
256 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||| ||||| |||||||||||||| ||||||||| |||| |
|
|
T |
12352395 |
ctgactgtgaattttcgctgatgtggcatgctgcgtcaccttttt |
12352351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 12566991 - 12566940
Alignment:
Q |
141 |
aataggtctttatccc--tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||||||||| ||||||| |
|
|
T |
12566991 |
aataggtctttacccccttgtaatatagggcacttttggttttgccccctgt |
12566940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 13910889 - 13910853
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||||||| |||||||||| |||||||| |
|
|
T |
13910889 |
ccctgtaatataggtcatttttggttttctcccctgt |
13910853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 34739908 - 34739944
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
34739908 |
ccctgtaatatagggcacttttggttttggcccctgt |
34739944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 34741431 - 34741395
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
34741431 |
ccctgtaatatagggcacttttggttttgccccctgt |
34741395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 256 - 300
Target Start/End: Original strand, 39865130 - 39865174
Alignment:
Q |
256 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||||| |||||||||||| || |||||| |||| |
|
|
T |
39865130 |
ctgactgtgcatttttggtgatgtggcatgatgtgtcaccttttt |
39865174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 256 - 300
Target Start/End: Complemental strand, 43860848 - 43860804
Alignment:
Q |
256 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| |||||||||||||| || |||||| |||| |
|
|
T |
43860848 |
ctgactgtgcattttcgctgatgtggcatgctgagtcaccttttt |
43860804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 231 - 283
Target Start/End: Complemental strand, 47766131 - 47766079
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
|||||||||||||||||| | |||||||||||| ||||| ||||||||||| |
|
|
T |
47766131 |
gttttggaaaacccctctaggccagctgactgtgtattttcactgatgtggca |
47766079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 51164058 - 51164022
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||| |||||||||||||||||||||||| ||||||| |
|
|
T |
51164058 |
ccctataatataggtcacttttggttttgccccctgt |
51164022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0725 (Bit Score: 59; Significance: 7e-25; HSPs: 2)
Name: scaffold0725
Description:
Target: scaffold0725; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 141 - 300
Target Start/End: Original strand, 3919 - 4079
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaa |
239 |
Q |
|
|
|||||||||||| ||| |||||| |||| |||||||||||||| ||||||| ||| |||| ||||||||||||| ||||||||| |
|
|
T |
3919 |
aataggtctttaccccctgtaatgtaggacacttttggttttgccccctgtaaaaaatttttttttgattcggtccttgtaaaaaaattttgttttggaa |
4018 |
T |
 |
Q |
240 |
aacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||| || || ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
4019 |
aacccccctagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcaccttttt |
4079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0725; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 154 - 300
Target Start/End: Complemental strand, 4994 - 4848
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| ||| |||| ||||||||||||| |||||||||||||| || |||| |
|
|
T |
4994 |
ccctgtaatataggtcacttttggttttgccccctgtaaattttttttttttgattcggtccttgtaaaatttttttgttttggaaaacccacctagatc |
4895 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||| | ||||||| |||| |
|
|
T |
4894 |
agctgactgtgcatttttgctgatgtggcatgctccgtcaccttttt |
4848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 7e-25; HSPs: 40)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 141 - 300
Target Start/End: Complemental strand, 29185033 - 29184873
Alignment:
Q |
141 |
aataggtcttta-tccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaa |
239 |
Q |
|
|
|||||| ||||| |||||||||||||||||||||||||||||| | ||||| ||| |||| | ||||||||||| ||||||||| |
|
|
T |
29185033 |
aataggcctttactccctgtaatataggtcacttttggttttgcctcctgtaaaaaaaaaaatttggattcgatccttgtaaaatttttttgttttggaa |
29184934 |
T |
 |
Q |
240 |
aacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||| || || ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
29184933 |
aacccccctagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcaccttttt |
29184873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 18141034 - 18141106
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| || || ||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
T |
18141034 |
gttttggaaaacccccctagaccagctgactgtgcatttttgctgatgtggcatgctgcatcaccctttttgg |
18141106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 303
Target Start/End: Complemental strand, 31173636 - 31173475
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaa |
240 |
Q |
|
|
|||||||||||| ||||||||||||| ||||||||||||||| ||||| ||| |||| |||||||||||| |||||||||| |
|
|
T |
31173636 |
aataggtctttacccctgtaatatagatcacttttggttttgcccccttgtaattttttttttttgattcagtccttgtaaaatttttttgttttggaaa |
31173537 |
T |
 |
Q |
241 |
acccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||| || || ||||||||||||||||||||| ||||||||||| ||||||||| ||||||| |
|
|
T |
31173536 |
acccc-ctagaccagctgactgtgcatttttgcagatgtggcatgctgcgtcaccttttttgg |
31173475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 303
Target Start/End: Complemental strand, 54567795 - 54567634
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaa |
239 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||||||| ||||| | ||| |||| ||||||||||||| ||||||||| |
|
|
T |
54567795 |
aataggtctttaccccctgtaatataggtcacttttggttttgccccctataaaaaaaaaa-tttggattcggtccttgtaaaatttttttgttttggaa |
54567697 |
T |
 |
Q |
240 |
aacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||| || || ||||||||||||||||||||||||||||||||| || |||||| ||||||| |
|
|
T |
54567696 |
aacccc-ctagaccagctgactgtgcatttttgctgatgtggcatgctgtgtcaccttttttgg |
54567634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 253 - 303
Target Start/End: Original strand, 48044388 - 48044438
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
48044388 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcaccttttttgg |
48044438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 154 - 295
Target Start/End: Complemental strand, 18142235 - 18142094
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| || |||| |||||||||||| ||||||||||||||| || || | |
|
|
T |
18142235 |
ccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaaaattggattaggtccttgtaaattttttttgttttggaaaacccccctagacc |
18142136 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacc |
295 |
Q |
|
|
|||||| ||||||||||||||||||||||||| | ||||||| |
|
|
T |
18142135 |
agctgattgtgcatttttgctgatgtggcatgctacgtcacc |
18142094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 232 - 303
Target Start/End: Original strand, 29183828 - 29183899
Alignment:
Q |
232 |
ttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||||||||||| || || ||||||||||||||||||||||||| || ||||||| |||| ||||||||| |
|
|
T |
29183828 |
ttttggaaaacccccctagaccagctgactgtgcatttttgctgatatgacatgttgtgtcagcctttttgg |
29183899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 38344342 - 38344273
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||| || || |||||||||||||||||||||||||||| |||| ||||||||| |||| |
|
|
T |
38344342 |
gttttggaaaaccctcctagaccagctgactgtgcatttttgctgatgtgacatgctgcgtcaccttttt |
38344273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 231 - 300
Target Start/End: Original strand, 43112122 - 43112191
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||||||| || ||||||| ||| ||||||||||||||||||||| ||| ||||| |||| |
|
|
T |
43112122 |
gttttggaaaacccctctagaccagctgattgtacatttttgctgatgtggcatgctgcatcaccttttt |
43112191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 4217773 - 4217844
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||||||||||||| | || ||||| ||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
T |
4217773 |
gttttggaaaacccct-tagaccagctaactgtgcatttttgctgatgtggcatgctgcgtcactttttttgg |
4217844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 148 - 190
Target Start/End: Original strand, 54566524 - 54566566
Alignment:
Q |
148 |
ctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
54566524 |
ctttacccctgtaatataggtcacttttggttttgtcccctgt |
54566566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 231 - 303
Target Start/End: Complemental strand, 43113000 - 43112928
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||| |||||||| || | ||||||||| |||||||||| |||||||||||| ||||||||| ||||||| |
|
|
T |
43113000 |
gttttgaaaaacccccctaaaccagctgactatgcatttttgttgatgtggcatgctgcgtcaccttttttgg |
43112928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 54566606 - 54566678
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| || || ||||| ||| |||||||||||| |||||||||| || |||||| ||||||| |
|
|
T |
54566606 |
gttttggaaaacccccctagaccagctaactatgcatttttgctaatgtggcatgatgtgtcaccttttttgg |
54566678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 255 - 294
Target Start/End: Original strand, 48076442 - 48076481
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcac |
294 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
48076442 |
gctgactgtgcatttttgctgatgtggcatgatgcgtcac |
48076481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 134 - 190
Target Start/End: Original strand, 10615273 - 10615330
Alignment:
Q |
134 |
tttggtcaataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||| |||||||||||| ||| ||||||||||| |||||||||||||| ||||||| |
|
|
T |
10615273 |
tttggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
10615330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 253 - 294
Target Start/End: Original strand, 34061463 - 34061504
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcac |
294 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||| |
|
|
T |
34061463 |
cagctgactgtgcatttttgctgatgtggcatgctgcatcac |
34061504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 255 - 300
Target Start/End: Complemental strand, 38243641 - 38243596
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||||||||| |||||||||| ||||||||| |||| |
|
|
T |
38243641 |
gctgactgtgcatttttgcttatgtggcatgatgcgtcaccttttt |
38243596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 231 - 283
Target Start/End: Original strand, 24909477 - 24909528
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
||||||||||||||| || || ||||||||| ||||||||||||||||||||| |
|
|
T |
24909477 |
gttttggaaaacccc-ctagaccagctgactatgcatttttgctgatgtggca |
24909528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 253 - 300
Target Start/End: Complemental strand, 51545146 - 51545099
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||| |||||||| |||||||||||||||||||| ||| |||| |
|
|
T |
51545146 |
cagctgactatgcattttcgctgatgtggcatgttgcgttaccttttt |
51545099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 37977558 - 37977508
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||||||||| ||||||| |
|
|
T |
37977558 |
aataggtctttaccccctgtaatataggacacttttggttttgccccctgt |
37977508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 46610014 - 46610064
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||||||||| ||||||| |
|
|
T |
46610014 |
aataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
46610064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 280
Target Start/End: Complemental strand, 4218828 - 4218779
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtg |
280 |
Q |
|
|
||||||||||||||| || | ||||||||||| |||||||||||||||| |
|
|
T |
4218828 |
gttttggaaaacccccctaaaccagctgactgtacatttttgctgatgtg |
4218779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 300
Target Start/End: Original strand, 11359553 - 11359621
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||| |||||||| || | ||||||||||||||||||| |||||||||||| | || |||||| |||| |
|
|
T |
11359553 |
gttttgaaaaacccc-ctagctcagctgactgtgcattttcgctgatgtggcacgctgagtcaccgtttt |
11359621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 24528393 - 24528442
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||| ||||| ||||||||||||| | | ||||||||||||||||||| |
|
|
T |
24528393 |
aatagggctttacccctgtaatatagattatttttggttttgtcccctgt |
24528442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 280
Target Start/End: Original strand, 38343280 - 38343328
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtg |
280 |
Q |
|
|
||||||||||||||| | || |||||||||||||||||||||||||||| |
|
|
T |
38343280 |
gttttggaaaacccca-tagaccagctgactgtgcatttttgctgatgtg |
38343328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 45291539 - 45291584
Alignment:
Q |
256 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacccttttt |
301 |
Q |
|
|
||||||||||||||| ||| ||||| |||||||||||||| ||||| |
|
|
T |
45291539 |
ctgactgtgcattttcgctaatgtgacatgttgcgtcacctttttt |
45291584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 300
Target Start/End: Original strand, 49263149 - 49263194
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||||| ||||||||||||| || |||||| |||| |
|
|
T |
49263149 |
gctgactgtgcatttttcctgatgtggcatgctgtgtcaccttttt |
49263194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 158 - 190
Target Start/End: Complemental strand, 4218900 - 4218868
Alignment:
Q |
158 |
gtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||||||||||||||| ||||||| |
|
|
T |
4218900 |
gtaatataggtcacttttggttttgccccctgt |
4218868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 10616811 - 10616775
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
10616811 |
ccctgtaatatagggcacttttggttttgccccctgt |
10616775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 182
Target Start/End: Original strand, 12210047 - 12210075
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttg |
182 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
12210047 |
ccctgtaatataggtcacttttggttttg |
12210075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 14824770 - 14824806
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||||||||||||| ||||| ||||||| |
|
|
T |
14824770 |
ccctgtaatataggtcacttttgattttgccccctgt |
14824806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 15086242 - 15086278
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
15086242 |
ccctgtaatatagggcacttttggttttgccccctgt |
15086278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 182
Target Start/End: Original strand, 18140959 - 18140987
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttg |
182 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
18140959 |
ccctgtaatataggtcacttttggttttg |
18140987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 135 - 190
Target Start/End: Original strand, 29313787 - 29313843
Alignment:
Q |
135 |
ttggtcaataggtctttatc-cctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||| |||||||||||| | |||||||||||||||| ||| |||||| |||||||| |
|
|
T |
29313787 |
ttggttaataggtctttacctcctgtaatataggtcattttcggttttctcccctgt |
29313843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 255 - 295
Target Start/End: Complemental strand, 34062273 - 34062233
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacc |
295 |
Q |
|
|
||||||||||||||||||||||||||| | |||| |||||| |
|
|
T |
34062273 |
gctgactgtgcatttttgctgatgtggtaagttgtgtcacc |
34062233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 34062376 - 34062340
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||| |
|
|
T |
34062376 |
ccctgtaatataggtcacttttggtttttccccctgt |
34062340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 182
Target Start/End: Original strand, 45291439 - 45291467
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttg |
182 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
45291439 |
ccctgtaatataggtcacttttggttttg |
45291467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 231 - 283
Target Start/End: Complemental strand, 46207927 - 46207875
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
||||||||||||||| || | |||||||||||||||||| ||| |||||||| |
|
|
T |
46207927 |
gttttggaaaacccccctagggcagctgactgtgcattttcgctaatgtggca |
46207875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 205 - 270
Target Start/End: Complemental strand, 48044715 - 48044650
Alignment:
Q |
205 |
agatttggtccttgtaaaannnnnnngttttggaaaacccctctggatcagctgactgtgcatttt |
270 |
Q |
|
|
|||||| |||||||||||| |||||||||||||||||| || ||||||||||||| |||| |
|
|
T |
48044715 |
agatttcgtccttgtaaaaattttttgttttggaaaacccctctagaccagctgactgtgcctttt |
48044650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 255 - 283
Target Start/End: Complemental strand, 49265229 - 49265201
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
49265229 |
gctgactgtgcatttttgctgatgtggca |
49265201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 1e-23; HSPs: 35)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 154 - 300
Target Start/End: Original strand, 34901521 - 34901667
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| ||| |||| |||||||||||| ||||||||||||||| || || | |
|
|
T |
34901521 |
ccctgtaatataggtcacttttggttttgccccctgtaaaaatatttttttggattcggtccttgtaaattttttttgttttggaaaacccccctagacc |
34901620 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
T |
34901621 |
agctgactgtgcatttttgctgatgtggcatgctgcgtcaccttttt |
34901667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 141 - 300
Target Start/End: Original strand, 2269047 - 2269208
Alignment:
Q |
141 |
aataggtcttta--tccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttgga |
238 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||||||| || | || ||| |||||||||||||||||| |||||||| |
|
|
T |
2269047 |
aataggtctttacctccttgtaatataggtcacttttggttttgccctcagtaaatttttttttttggatttggtccttgtaaaatttttttgttttgga |
2269146 |
T |
 |
Q |
239 |
aaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||| || || |||||||||||||||||||| |||||||||||||| ||| |||||| |||| |
|
|
T |
2269147 |
aaactcccctagatcagctgactgtgcatttatgctgatgtggcattttgtgtcaccttttt |
2269208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 154 - 303
Target Start/End: Complemental strand, 34902775 - 34902626
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||| |||||||||||| ||||||| ||| |||| ||||||||||||| ||||||| ||||||| || || | |
|
|
T |
34902775 |
ccctgtaatataggttacttttggttttcccccctgtaattttttttttttggattcggtccttgtaaaatttttttgttttggcaaacccccctagacc |
34902676 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
34902675 |
aactgactgtgcatttttgctgatgtggcatgttgcgtcactttttttgg |
34902626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 231 - 293
Target Start/End: Complemental strand, 39515080 - 39515018
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtca |
293 |
Q |
|
|
|||||||||||||| || || ||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
39515080 |
gttttggaaaaccctcctagaccagctgactgtgcatttttgctgatgtggcatgctgcgtca |
39515018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 31986191 - 31986122
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || || |||||||||||||||||||||||||||||||| | ||||||| |||| |
|
|
T |
31986191 |
gttttggaaaacccccctagactagctgactgtgcatttttgctgatgtggcatgctccgtcaccttttt |
31986122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 231 - 303
Target Start/End: Complemental strand, 35322431 - 35322359
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| | || ||||||||||||| ||||||||||||||||||| ||| ||||| ||||||| |
|
|
T |
35322431 |
gttttggaaaacccccatagaccagctgactgtgcttttttgctgatgtggcatgatgcctcaccttttttgg |
35322359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 154 - 303
Target Start/End: Original strand, 39513886 - 39514032
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| || |||| ||||||||||||| ||||||||||||||| || || | |
|
|
T |
39513886 |
ccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaa--ttggattcggtccttgtaaaatatttttgttttggaaaacccc-ctagacc |
39513982 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||| ||||| | ||||||||||||||||||| ||||||||| ||||||| |
|
|
T |
39513983 |
agcttactgtacttttttgctgatgtggcatgctgcgtcaccttttttgg |
39514032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 231 - 285
Target Start/End: Complemental strand, 2270250 - 2270197
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatg |
285 |
Q |
|
|
||||||||||||||| || || ||||||||||||||||||||||||||||||||| |
|
|
T |
2270250 |
gttttggaaaacccc-ctagaccagctgactgtgcatttttgctgatgtggcatg |
2270197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 300
Target Start/End: Original strand, 37402581 - 37402650
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || | ||||||||||||||||||| |||||||||||| | || |||||| |||| |
|
|
T |
37402581 |
gttttggaaaacccccctaggtcagctgactgtgcattttcgctgatgtggcacgctgagtcaccatttt |
37402650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 39808654 - 39808703
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
T |
39808654 |
aataggtctttacccctgtaatatagggcacttttggttttgccccctgt |
39808703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 285
Target Start/End: Original strand, 31985016 - 31985163
Alignment:
Q |
141 |
aataggtcttta--tccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnnttta-gatttggtccttgtaaaannnnnnngttttgg |
237 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||| ||||| | ||| |||| ||||||||||||| ||||||| |
|
|
T |
31985016 |
aataggtctttacctccctgtaatataggtcacttttggttttgccccctataatttttattttttttgattcggtccttgtaaaatgtttttgttttgg |
31985115 |
T |
 |
Q |
238 |
aaaacccctctggatcagctgactgtgcatttttgctgatgtggcatg |
285 |
Q |
|
|
|||||||| || | ||||||||||||||||||| |||||||||||| |
|
|
T |
31985116 |
aaaacccccctaaacaagctgactgtgcatttttgttgatgtggcatg |
31985163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 255 - 300
Target Start/End: Original strand, 39451624 - 39451669
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||||||||| |||||||||| ||||||||| |||| |
|
|
T |
39451624 |
gctgactgtgcatttttgcttatgtggcatgatgcgtcaccttttt |
39451669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 9768342 - 9768306
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||| |
|
|
T |
9768342 |
ccctgtaatataggtcacttttgattttgtcccctgt |
9768306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 247 - 295
Target Start/End: Complemental strand, 34504128 - 34504080
Alignment:
Q |
247 |
ctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcacc |
295 |
Q |
|
|
|||| |||||||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
34504128 |
ctgggtcagctgactgtgcatttccgctgatgtggcatgttgtgtcacc |
34504080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 231 - 294
Target Start/End: Complemental strand, 6820043 - 6819980
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcac |
294 |
Q |
|
|
|||||| |||||||| || | |||||||||||||||||| |||||||||||||| || ||||| |
|
|
T |
6820043 |
gttttgaaaaacccccctagcccagctgactgtgcattttcgctgatgtggcatgctgagtcac |
6819980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 2270343 - 2270293
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| |||| ||||||||||||||||||||| ||||||| |
|
|
T |
2270343 |
aataggtctttaccccctgtattataggtcacttttggttttgccccctgt |
2270293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 27164710 - 27164660
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||||||||| ||||||| |
|
|
T |
27164710 |
aataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
27164660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 261 - 295
Target Start/End: Complemental strand, 34375067 - 34375033
Alignment:
Q |
261 |
tgtgcatttttgctgatgtggcatgttgcgtcacc |
295 |
Q |
|
|
|||||||||||||||||||||||||||| |||||| |
|
|
T |
34375067 |
tgtgcatttttgctgatgtggcatgttgtgtcacc |
34375033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 4105331 - 4105282
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||||||||||||||||| |||| ||||| ||| |||| |
|
|
T |
4105331 |
aataggtctttacccctgtaatataggtcattttttgttttctcctctgt |
4105282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 186
Target Start/End: Complemental strand, 26447634 - 26447589
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgtccc |
186 |
Q |
|
|
|||||||||||| ||||||||||||||||| ||||| |||| |||| |
|
|
T |
26447634 |
aataggtctttacccctgtaatataggtcatttttgattttttccc |
26447589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 285
Target Start/End: Original strand, 27407492 - 27407521
Alignment:
Q |
256 |
ctgactgtgcatttttgctgatgtggcatg |
285 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
27407492 |
ctgactgtgcatttttgctgatgtggcatg |
27407521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 231 - 283
Target Start/End: Original strand, 6819292 - 6819344
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
|||||| |||||||| || | |||||||||||||||||| |||||||||||| |
|
|
T |
6819292 |
gttttgaaaaacccccctagcccagctgactgtgcattttcgctgatgtggca |
6819344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 27163136 - 27163172
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
27163136 |
ccctgtaatatagggcacttttggttttggcccctgt |
27163172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 181
Target Start/End: Original strand, 34374234 - 34374274
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||| ||||||||||||||||| ||||| |||| |
|
|
T |
34374234 |
aataggtctttacccctgtaatataggtcaattttgatttt |
34374274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 181
Target Start/End: Complemental strand, 34504227 - 34504188
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||| |||||||||||| ||||||||||||||| |
|
|
T |
34504227 |
aataggtcttta-ccctgtaatatatgtcacttttggtttt |
34504188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 35322502 - 35322466
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||| |||||||||||||||||| |||| |
|
|
T |
35322502 |
ccctgtaatatagatcacttttggttttgtccactgt |
35322466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 238 - 301
Target Start/End: Complemental strand, 37125355 - 37125291
Alignment:
Q |
238 |
aaaacccctctggatc-agctgactgtgcatttttgctgatgtggcatgttgcgtcacccttttt |
301 |
Q |
|
|
||||||||||||| | |||||||||||||||| |||||||||||| | ||||||||| ||||| |
|
|
T |
37125355 |
aaaacccctctggcgctagctgactgtgcatttacgctgatgtggcacgctgcgtcacctttttt |
37125291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 231 - 283
Target Start/End: Complemental strand, 37403420 - 37403368
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
||||||||||||||| || | |||||||||||||||||| ||||||||||| |
|
|
T |
37403420 |
gttttggaaaacccccctaggccagctgactgtgcattttcactgatgtggca |
37403368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 181
Target Start/End: Complemental strand, 38500565 - 38500525
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||| ||||||||||||||||| ||| |||||| |
|
|
T |
38500565 |
aataggtctttacccctgtaatataggtcattttcggtttt |
38500525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 39452389 - 39452353
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||||||||||||||| |||||||| |
|
|
T |
39452389 |
ccctgtaatataagtcacttttggttttttcccctgt |
39452353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 180
Target Start/End: Complemental strand, 39515174 - 39515134
Alignment:
Q |
141 |
aataggtcttta-tccctgtaatataggtcacttttggttt |
180 |
Q |
|
|
|||||| ||||| |||||||||||||||||||||||||||| |
|
|
T |
39515174 |
aataggcctttactccctgtaatataggtcacttttggttt |
39515134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 39810124 - 39810088
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
39810124 |
ccctgtaatatagggcacttttggttttgccccctgt |
39810088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 181
Target Start/End: Complemental strand, 40652705 - 40652665
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||| ||||||||||||||||| || ||||||| |
|
|
T |
40652705 |
aataggtctttacccctgtaatataggtcatttctggtttt |
40652665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 40702048 - 40702012
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||||||||||| |||||| ||||||| |
|
|
T |
40702048 |
ccctgtaatataggtcacttttcgttttgccccctgt |
40702012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 42348981 - 42349017
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
42348981 |
ccctgtaatatagggcacttttggttttgccccctgt |
42349017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 1e-23; HSPs: 53)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 47145246 - 47145318
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
47145246 |
gttttggaaaaccccgctagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcaccttttttgg |
47145318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 24545553 - 24545625
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||| |||||||| || || ||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
T |
24545553 |
gttttgaaaaacccccctagaccagctgactgtgcatttttgctgatgtggcatgctgcgtcaccttttttgg |
24545625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 24546592 - 24546523
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||| ||| || || ||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
T |
24546592 |
gttttggaaaaaccccctagaccagctgactgtgcatttttgctgatgtggcatgttgcatcaccttttt |
24546523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 232 - 300
Target Start/End: Complemental strand, 13903363 - 13903296
Alignment:
Q |
232 |
ttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||| | || ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
13903363 |
ttttggaaaaccccccaggc-cagctgactgtgcatttttgctgatgtggcatgttgcgtcaccttttt |
13903296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 31645330 - 31645401
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| || || |||||||||||||||||||||||||||| |||| ||||||||| ||||||| |
|
|
T |
31645330 |
gttttggaaaacccc-ctagaccagctgactgtgcatttttgctgatgtgacatgctgcgtcaccttttttgg |
31645401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 231 - 295
Target Start/End: Original strand, 48716418 - 48716482
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcacc |
295 |
Q |
|
|
|||||| |||||||| || || ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
48716418 |
gttttgaaaaacccccctagaccagctgactatgcatttttgctgatgtggcatgttgcgtcacc |
48716482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 154 - 295
Target Start/End: Complemental strand, 1826472 - 1826331
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||| ||||| ||||||| ||| ||| ||||||||||||| ||||||||||||||| | || | |
|
|
T |
1826472 |
ccctgtaatataggtcacttttgattttgccccctgtaaattttttttttttgatccggtccttgtaaaaaaattttgttttggaaaacccccttagacc |
1826373 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacc |
295 |
Q |
|
|
|| |||||||||||||||||||||||||||||||| |||||| |
|
|
T |
1826372 |
agttgactgtgcatttttgctgatgtggcatgttgtgtcacc |
1826331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 141 - 285
Target Start/End: Original strand, 26095819 - 26095964
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaa |
239 |
Q |
|
|
|||||||||||| ||| ||||||||||||||||| |||||||| ||||||| ||| |||| ||||||||||||| |||||| || |
|
|
T |
26095819 |
aataggtctttaccccctgtaatataggtcacttatggttttgccccctgtaaaaaaaaattttttgattcggtccttgtaaaatttttttgttttgaaa |
26095918 |
T |
 |
Q |
240 |
aacccctctggatcagctgactgtgcatttttgctgatgtggcatg |
285 |
Q |
|
|
||||| || || ||||||||||||||||||||||||||||||||| |
|
|
T |
26095919 |
tacccccctagaccagctgactgtgcatttttgctgatgtggcatg |
26095964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 231 - 300
Target Start/End: Original strand, 4414008 - 4414076
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || | |||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
T |
4414008 |
gttttggaaaacccc-ctaggccagctgactgtgcatttttgctaatgtggcatgttgcgtcaccttttt |
4414076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 231 - 282
Target Start/End: Complemental strand, 26096990 - 26096939
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggc |
282 |
Q |
|
|
||||||||||||||| || || |||||||||||||||||||||||||||||| |
|
|
T |
26096990 |
gttttggaaaacccccctagaccagctgactgtgcatttttgctgatgtggc |
26096939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 141 - 285
Target Start/End: Original strand, 1825299 - 1825441
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaa |
239 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||||||| ||||||| ||| ||| ||||||||||||| ||||||||| |
|
|
T |
1825299 |
aataggtctttaccccctgtaatataggtcacttttggttttgccccctgt---aaatattttttttattcggtccttgtaaaaaaaatttgttttggaa |
1825395 |
T |
 |
Q |
240 |
aacccctctggatcagctgactgtgcatttttgctgatgtggcatg |
285 |
Q |
|
|
|||||| || || ||| ||| ||||||||||||||||||||||||| |
|
|
T |
1825396 |
aacccccctagaccagttgagtgtgcatttttgctgatgtggcatg |
1825441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 231 - 285
Target Start/End: Complemental strand, 31648548 - 31648494
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatg |
285 |
Q |
|
|
||||||||||||||| || | ||||||||||||||||||||||||||||||||| |
|
|
T |
31648548 |
gttttggaaaacccccctaaaccagctgactgtgcatttttgctgatgtggcatg |
31648494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 253 - 303
Target Start/End: Complemental strand, 32131868 - 32131818
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
T |
32131868 |
cagctgactgtgcatttttgctgatttggcatgctgcgtcaccttttttgg |
32131818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 300
Target Start/End: Original strand, 32130740 - 32130809
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||| || | || |||||||||||||||||||||||||||| ||||||| |||||| |||| |
|
|
T |
32130740 |
gttttggaaaacacccgtagaccagctgactgtgcatttttgctgatgtgacatgttgtgtcaccttttt |
32130809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 31648171 - 31648243
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||| | || || ||||||||||||||||||| |||||||| |||| || |||||| ||||||| |
|
|
T |
31648171 |
gttttggaaaaccgccctagaccagctgactgtgcatttttactgatgtgacatgatgtgtcaccttttttgg |
31648243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 253 - 293
Target Start/End: Complemental strand, 47146326 - 47146286
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtca |
293 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
47146326 |
cagctgactgtgcatttttgctgatgtgacatgttgcgtca |
47146286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 253 - 300
Target Start/End: Original strand, 14978426 - 14978473
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||| ||||||||||||||||||||||||| ||||||| |||| |
|
|
T |
14978426 |
cagctgactatgcatttttgctgatgtggcatgttacgtcaccttttt |
14978473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 231 - 294
Target Start/End: Original strand, 35978816 - 35978879
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcac |
294 |
Q |
|
|
||||||||||||||| || | ||||||||||||||||||||| ||||||||||| || ||||| |
|
|
T |
35978816 |
gttttggaaaacccccctaggtcagctgactgtgcatttttgtagatgtggcatgctgtgtcac |
35978879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 253 - 303
Target Start/End: Complemental strand, 4415113 - 4415063
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||| || ||| ||||||| |
|
|
T |
4415113 |
cagctgactgtgcatttttgctgatgtgacatgttgtgttaccttttttgg |
4415063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 255 - 300
Target Start/End: Original strand, 22591400 - 22591445
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||||||||| |||||||||| ||||||||| |||| |
|
|
T |
22591400 |
gctgactgtgcatttttgctaatgtggcatgatgcgtcaccttttt |
22591445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 255 - 300
Target Start/End: Original strand, 28414858 - 28414903
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||||||||||||||||||| || |||||| |||| |
|
|
T |
28414858 |
gctgactgtgcatttttgctgatgtggcatgctgtgtcaccttttt |
28414903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 33645926 - 33645857
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||| ||| || ||||||||| || |||||| ||||||||||||| || |||||| |||| |
|
|
T |
33645926 |
gttttggaaaacccttctagaccagctgactatgtatttttactgatgtggcatgctgggtcaccttttt |
33645857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 132 - 181
Target Start/End: Original strand, 45832158 - 45832207
Alignment:
Q |
132 |
aatttggtcaataggtctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||| ||| ||||||| |||||||||||||||||| |||||||||||||| |
|
|
T |
45832158 |
aattgggttaataggtatttatccctgtaatatagatcacttttggtttt |
45832207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 49201345 - 49201276
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || | |||||||||||||||||| |||||||||||| | || |||||| |||| |
|
|
T |
49201345 |
gttttggaaaacccccctaggccagctgactgtgcattttcgctgatgtggcacgctgagtcaccgtttt |
49201276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 295
Target Start/End: Original strand, 20132453 - 20132541
Alignment:
Q |
206 |
gatttggtccttgtaaaannnnnnngttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcacc |
295 |
Q |
|
|
|||||||||||||||||| ||||||||||||||| || | |||||| | ||||||||||||||||||||||| ||||||||| |
|
|
T |
20132453 |
gatttggtccttgtaaaatttgtttgttttggaaaacccc-ctaggccagctggcaatgcatttttgctgatgtggcatgctgcgtcacc |
20132541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 33667670 - 33667634
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| |
|
|
T |
33667670 |
ccctgtaatataggtcacttttggttttgccccctgt |
33667634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 231 - 283
Target Start/End: Original strand, 44753394 - 44753446
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
||||||||||||||| || | |||||||||||||||||| |||||||||||| |
|
|
T |
44753394 |
gttttggaaaacccccctaggccagctgactgtgcattttcgctgatgtggca |
44753446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 231 - 294
Target Start/End: Original strand, 13902157 - 13902219
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcac |
294 |
Q |
|
|
||||||||||||||| || || ||||||||||||||| |||| |||||||||||| || ||||| |
|
|
T |
13902157 |
gttttggaaaacccc-ctagaccagctgactgtgcatctttgttgatgtggcatgctgtgtcac |
13902219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 232 - 291
Target Start/End: Original strand, 31837799 - 31837857
Alignment:
Q |
232 |
ttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgt |
291 |
Q |
|
|
||||| |||||||| || ||||||||||||||| |||||| ||||||||||||| ||||| |
|
|
T |
31837799 |
ttttgaaaaacccc-ctagatcagctgactgtgtatttttactgatgtggcatgctgcgt |
31837857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 231 - 282
Target Start/End: Complemental strand, 33667584 - 33667533
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggc |
282 |
Q |
|
|
||||||||||||||| | || ||| |||||||||||||||||||||||||| |
|
|
T |
33667584 |
gttttggaaaacccccttagaccagttgactgtgcatttttgctgatgtggc |
33667533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 253 - 300
Target Start/End: Complemental strand, 51471120 - 51471073
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||| ||||||||||||||||||||||| || |||||| |||| |
|
|
T |
51471120 |
cagctgactctgcatttttgctgatgtggcatgctgtgtcaccttttt |
51471073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 148 - 190
Target Start/End: Complemental strand, 7780265 - 7780223
Alignment:
Q |
148 |
ctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||| ||||||||||||| ||||||||||||||| ||||||| |
|
|
T |
7780265 |
ctttacccctgtaatatagatcacttttggttttgccccctgt |
7780223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 14625375 - 14625425
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||||||||| ||||||| |
|
|
T |
14625375 |
aataggtctttaccccctgtaatataggacacttttggttttgccccctgt |
14625425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 26097079 - 26097029
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||||||| | ||||| |
|
|
T |
26097079 |
aataggtctttaccccctgtaatataggtcacttttggttttgcctcctgt |
26097029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 300
Target Start/End: Original strand, 24962783 - 24962828
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||||||||| |||||||||| ||| ||||| |||| |
|
|
T |
24962783 |
gctgactgtgcatttttgctcatgtggcatgatgcatcaccttttt |
24962828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 25601878 - 25601809
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || | |||||||||| ||||||| |||||||||||| | || |||||| |||| |
|
|
T |
25601878 |
gttttggaaaacccccctaggccagctgactgggcattttcgctgatgtggcacgctgagtcaccatttt |
25601809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 190
Target Start/End: Original strand, 31648098 - 31648131
Alignment:
Q |
157 |
tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||||||||||||||| |||||||| |
|
|
T |
31648098 |
tgtaatataggtcacttttggttttatcccctgt |
31648131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 300
Target Start/End: Complemental strand, 45833114 - 45833069
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||| ||||||||||||||||||||||||| |||||| |||| |
|
|
T |
45833114 |
gctgactaggcatttttgctgatgtggcatgttgtgtcaccttttt |
45833069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 303
Target Start/End: Complemental strand, 48717254 - 48717205
Alignment:
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||||||| ||||||||||||||||||||| || ||||| ||||||| |
|
|
T |
48717254 |
agctgactgtacatttttgctgatgtggcatgatgtgtcacattttttgg |
48717205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 12277491 - 12277455
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||||||| |||||||||| |||||||| |
|
|
T |
12277491 |
ccctgtaatataggtcatttttggttttctcccctgt |
12277455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 182
Target Start/End: Complemental strand, 13903409 - 13903381
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttg |
182 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
13903409 |
ccctgtaatataggtcacttttggttttg |
13903381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 13917308 - 13917272
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| ||||||||||||| |||||||| |
|
|
T |
13917308 |
ccctgtaatataggacacttttggttttctcccctgt |
13917272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 16785741 - 16785777
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||| ||||||||||||||||||| ||||||| |
|
|
T |
16785741 |
ccctgtaatgtaggtcacttttggttttgccccctgt |
16785777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 182
Target Start/End: Original strand, 20132401 - 20132429
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttg |
182 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
20132401 |
ccctgtaatataggtcacttttggttttg |
20132429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 255 - 295
Target Start/End: Complemental strand, 22592269 - 22592229
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacc |
295 |
Q |
|
|
||||||| |||||||||||| ||||||||||||| |||||| |
|
|
T |
22592269 |
gctgactatgcatttttgcttatgtggcatgttgtgtcacc |
22592229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 24730241 - 24730205
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||| |
|
|
T |
24730241 |
ccctgtaatataggtcacttttggttttcccccctgt |
24730205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 31648624 - 31648588
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||||| | ||||||||||||||||||| |
|
|
T |
31648624 |
ccctgtaatataggttatttttggttttgtcccctgt |
31648588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 33934657 - 33934693
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||| ||||||||||||||| ||||||| |
|
|
T |
33934657 |
ccctgtaatatagatcacttttggttttgccccctgt |
33934693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 231 - 283
Target Start/End: Complemental strand, 35979543 - 35979492
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
||||||| ||||||| || || ||||||||||||||||||||||||| ||||| |
|
|
T |
35979543 |
gttttggcaaacccc-ctagaccagctgactgtgcatttttgctgatttggca |
35979492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 188
Target Start/End: Original strand, 43635840 - 43635888
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccct |
188 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||||||||| ||||| |
|
|
T |
43635840 |
aataggtctttaccccctgtaatatagggcacttttggttttgccccct |
43635888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 182
Target Start/End: Complemental strand, 47146421 - 47146378
Alignment:
Q |
141 |
aataggtctttatccc--tgtaatataggtcacttttggttttg |
182 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||||||| |
|
|
T |
47146421 |
aataggtctttacccccttgtaatataggtcacttttggttttg |
47146378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 232 - 300
Target Start/End: Complemental strand, 47221904 - 47221836
Alignment:
Q |
232 |
ttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||| |||| ||||||||||||||||||||||||||| ||| | || |||||| |||| |
|
|
T |
47221904 |
ttttggaaaaccgctctaagccagctgactgtgcatttttgctgatgtagcacgctgggtcaccgtttt |
47221836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 52084863 - 52084827
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||| |||||||||||||||||||||| |
|
|
T |
52084863 |
ccctgtaatatagagcacttttggttttgtcccctgt |
52084827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 4e-23; HSPs: 22)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 154 - 303
Target Start/End: Original strand, 1589405 - 1589554
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| ||| |||| | ||||||||||| ||||||||||||||| || | | |
|
|
T |
1589405 |
ccctgtaatataggtcacttttggttttgccccctgtaaaattttttttttcgattcgatccttgtaaaatttgtttgttttggaaaacccccctaaacc |
1589504 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
T |
1589505 |
agctgactgtgcatttttgctgatgtggcatgctgcgtcatcctttttgg |
1589554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 5218998 - 5218929
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || || ||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
T |
5218998 |
gttttggaaaacccccctagaccagctgactgtgcatttttgctgatgtggcatgttgcatcaccttttt |
5218929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 5217862 - 5217934
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| || || |||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
T |
5217862 |
gttttggaaaacccccctagaccagctgactgtgcatttttgctgatgtggcatgttggatcagcctttttgg |
5217934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 231 - 303
Target Start/End: Complemental strand, 27159347 - 27159275
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||| |||||| || |||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
T |
27159347 |
gttttggaaaatccctctagactagctgactgtgcatttttgctgatgtggcatgctgcgtcaccttttttgg |
27159275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 24757951 - 24757882
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || || ||||||||||||| ||||||||||||||||||| ||||||||| |||| |
|
|
T |
24757951 |
gttttggaaaacccccctagaccagctgactgtgcgtttttgctgatgtggcatgctgcgtcaccttttt |
24757882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 45865614 - 45865545
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||| ||| || || ||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
T |
45865614 |
gttttggaaaaaccccctagaccagctgactgtgcatttttgctgatgtggcatgatgcgtcaccttttt |
45865545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 3766678 - 3766609
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
T |
3766678 |
gttttggaaaacccatctacgccagctgactgtgcatttttgctgatgtggcatgttgtgtcaccttttt |
3766609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 141 - 284
Target Start/End: Complemental strand, 1594176 - 1594032
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaa |
239 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||||||| | |||| ||| |||| |||||||||||| ||||||||| |
|
|
T |
1594176 |
aataggtctttaccccctgtaatataggtcacttttggttttgcctcctgcaaaaaaaaaaatttggattcggtccttgtaaattttttttgttttggaa |
1594077 |
T |
 |
Q |
240 |
aacccctctggatcagctgactgtgcatttttgctgatgtggcat |
284 |
Q |
|
|
|||||| || || ||||||||||||||||||||||||| |||||| |
|
|
T |
1594076 |
aacccccctagaccagctgactgtgcatttttgctgatatggcat |
1594032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 231 - 295
Target Start/End: Original strand, 45864525 - 45864589
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcacc |
295 |
Q |
|
|
||||||||||| ||| || || ||||||||||||||||||||| ||||||||||| ||| ||||| |
|
|
T |
45864525 |
gttttggaaaaaccccctagaccagctgactgtgcatttttgcagatgtggcatgctgcatcacc |
45864589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 16902388 - 16902340
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||||||||||||||||| |||||||||| |||||||| |
|
|
T |
16902388 |
aataggtctttacccctgtaatataggtcatttttggtttt-tcccctgt |
16902340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 48104514 - 48104563
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||||||||||||||||| |||| ||||| |||||||| |
|
|
T |
48104514 |
aataggtctttacccctgtaatataggtcattttttgttttctcccctgt |
48104563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 231 - 280
Target Start/End: Original strand, 48945280 - 48945329
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtg |
280 |
Q |
|
|
|||||| ||||||||||| | |||||||||||||||||||||||||||| |
|
|
T |
48945280 |
gttttgaaaaacccctctataccagctgactgtgcatttttgctgatgtg |
48945329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 256 - 295
Target Start/End: Complemental strand, 21237286 - 21237247
Alignment:
Q |
256 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacc |
295 |
Q |
|
|
|||||||||||||||||||||||||||||| || |||||| |
|
|
T |
21237286 |
ctgactgtgcatttttgctgatgtggcatgctgtgtcacc |
21237247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 48168855 - 48168905
Alignment:
Q |
141 |
aataggtctttatcc-ctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| || |||||||||||| |||||||||||||| ||||||| |
|
|
T |
48168855 |
aataggtctttaccctctgtaatatagggcacttttggttttgccccctgt |
48168905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 182
Target Start/End: Original strand, 48896484 - 48896526
Alignment:
Q |
141 |
aataggtctttatc-cctgtaatataggtcacttttggttttg |
182 |
Q |
|
|
|||||||||||| | |||||||||||||||||||||||||||| |
|
|
T |
48896484 |
aataggtctttacctcctgtaatataggtcacttttggttttg |
48896526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 181
Target Start/End: Complemental strand, 21298297 - 21298256
Alignment:
Q |
141 |
aataggtctttatccct-gtaatataggtcacttttggtttt |
181 |
Q |
|
|
||||||||||||||||| ||||||||||||| |||||||||| |
|
|
T |
21298297 |
aataggtctttatcccttgtaatataggtcatttttggtttt |
21298256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 284
Target Start/End: Original strand, 38092132 - 38092185
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcat |
284 |
Q |
|
|
||||||||||||||| || | |||| ||| ||||||||||| |||||||||||| |
|
|
T |
38092132 |
gttttggaaaaccccgctaggtcagttgattgtgcatttttactgatgtggcat |
38092185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 5219074 - 5219038
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||||||||||||| ||||| ||||||| |
|
|
T |
5219074 |
ccctgtaatataggtcacttttgattttgccccctgt |
5219038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 253 - 293
Target Start/End: Complemental strand, 9351609 - 9351569
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtca |
293 |
Q |
|
|
|||||||||||||||||| |||||||||||| |||| |||| |
|
|
T |
9351609 |
cagctgactgtgcattttcgctgatgtggcacgttgagtca |
9351569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 17763341 - 17763392
Alignment:
Q |
141 |
aataggtctttatccct--gtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| |||| |||||||||| |||||||||||||| ||||||| |
|
|
T |
17763341 |
aataggtctttacccctctgtaatataggacacttttggttttgccccctgt |
17763392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 181
Target Start/End: Complemental strand, 44414129 - 44414089
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||| ||||||||||||||||| || ||||||| |
|
|
T |
44414129 |
aataggtctttacccctgtaatataggtcatttatggtttt |
44414089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 45865689 - 45865653
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||| |
|
|
T |
45865689 |
ccctgtaatataggtcacttttggttttaccccctgt |
45865653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 4e-23; HSPs: 37)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 154 - 303
Target Start/End: Original strand, 15747770 - 15747918
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||| ||| ||| ||||||||||||| ||||||||||||||| || || |
|
|
T |
15747770 |
ccctgtaatataggtcacttttggttttgttccctgtaaaaacaaatttttcaattcggtccttgtaaaatttttttgttttggaaaacccc-ctagact |
15747868 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
15747869 |
agctgactgtgcatttttgctgatgtggcatgttgtgtcaccctttttgg |
15747918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 141 - 303
Target Start/End: Original strand, 44241102 - 44241264
Alignment:
Q |
141 |
aataggtcttta-tccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaa |
239 |
Q |
|
|
|||||| ||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
T |
44241102 |
aataggactttactccctgtaatataggtcatttttggttttgtcccctgtaaaaaaaaaattttagatttggtccttgtaaaaaaattttgttttggaa |
44241201 |
T |
 |
Q |
240 |
aacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||| || | |||||||||||| | |||||||||||||||||| | |||| || ||||||| |
|
|
T |
44241202 |
aacccccctaaaccagctgactgtgta-ttttgctgatgtggcatgctccgtctccttttttgg |
44241264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 154 - 303
Target Start/End: Complemental strand, 22468262 - 22468116
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| || |||| ||||||||||||| ||||||||||||||| || || | |
|
|
T |
22468262 |
ccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaa--ttggattaggtccttgtaaaacttttttgttttggaaaacccc-ctagacc |
22468166 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||| |||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
T |
22468165 |
agcagactgtgcatttttgctgatgtggcatgctgcgtcaccttttttgg |
22468116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 154 - 303
Target Start/End: Complemental strand, 22474483 - 22474337
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnntttagatttggtccttgtaaaannnnnnngttttggaaaacccctctggatc |
253 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| || |||| ||||||||||||| ||||||||||||||| || || | |
|
|
T |
22474483 |
ccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaa--ttggattaggtccttgtaaaacttttttgttttggaaaacccc-ctagacc |
22474387 |
T |
 |
Q |
254 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||| |||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
T |
22474386 |
agcagactgtgcatttttgctgatgtggcatgctgcgtcaccttttttgg |
22474337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 136 - 303
Target Start/End: Original strand, 22466981 - 22467151
Alignment:
Q |
136 |
tggtcaataggtctttatccc--tgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnn-tttagatttggtccttgtaaaannnnnnngt |
232 |
Q |
|
|
|||| |||||||||||| ||| |||||||||||||||||||||||||||||||||| ||| |||| ||||||||||| || |
|
|
T |
22466981 |
tggttaataggtctttacccccctgtaatataggtcacttttggttttgtcccctgtaaaaaaaaaaaatttggattcaatccttgtaaaaaaaatttgt |
22467080 |
T |
 |
Q |
233 |
tttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||| | || ||||||||||||||||||||||||||||||||| || |||||| ||||||| |
|
|
T |
22467081 |
tttggaaaacccccttagaccagctgactgtgcatttttgctgatgtggcatgctgtgtcaccttttttgg |
22467151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 11830018 - 11829972
Alignment:
Q |
257 |
tgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
11830018 |
tgactgtgcatttttgctgatgtggcatgttgcgtcaccttttttgg |
11829972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 231 - 303
Target Start/End: Original strand, 28461160 - 28461231
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||| | || || ||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
T |
28461160 |
gttttggaaaaccccg-tagaccacctgactgtgcatttttgctgatgtggcatgttgtgtcaccttttttgg |
28461231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 231 - 303
Target Start/End: Complemental strand, 44242317 - 44242245
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
|||||||||||||| || || ||||||||| ||||||||||||||||||||||| | ||||||| ||||||| |
|
|
T |
44242317 |
gttttggaaaaccctcctagaccagctgactatgcatttttgctgatgtggcatgctccgtcaccttttttgg |
44242245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 231 - 294
Target Start/End: Complemental strand, 28142851 - 28142788
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcac |
294 |
Q |
|
|
|||||||||||||||||| | || ||||| |||||||||||||||||||||||| |||||||| |
|
|
T |
28142851 |
gttttggaaaacccctctaggccaactgacagtgcatttttgctgatgtggcatgctgcgtcac |
28142788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 233 - 300
Target Start/End: Complemental strand, 28462451 - 28462384
Alignment:
Q |
233 |
tttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||| | || || |||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
T |
28462451 |
tttggaaaacctcactagaccagctgactgtgcatttttgctgatgtggcatactgcgtcaccttttt |
28462384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 15748970 - 15748901
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || || ||||||||||| |||||||||| |||||||| | ||||||||| |||| |
|
|
T |
15748970 |
gttttggaaaacccccctagagcagctgactgtacatttttgctaatgtggcacgctgcgtcaccttttt |
15748901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 231 - 294
Target Start/End: Original strand, 28141786 - 28141849
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcac |
294 |
Q |
|
|
||||||||||||||| | | ||||||||||||||||||||||||| ||||||| |||||||| |
|
|
T |
28141786 |
gttttggaaaacccccataggccagctgactgtgcatttttgctgatttggcatgctgcgtcac |
28141849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 38528600 - 38528643
Alignment:
Q |
260 |
ctgtgcatttttgctgatgtggcatgttgcgtcaccctttttgg |
303 |
Q |
|
|
||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
T |
38528600 |
ctgtgcatttttgctgatgtggcatgttgtgtcaccttttttgg |
38528643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 148 - 190
Target Start/End: Complemental strand, 43015245 - 43015203
Alignment:
Q |
148 |
ctttatccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
T |
43015245 |
ctttacccctgtaatataggtcatttttggttttgtcccctgt |
43015203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 182
Target Start/End: Original strand, 38935950 - 38935991
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttg |
182 |
Q |
|
|
|||||||||||| |||||||||||||| |||||||||||||| |
|
|
T |
38935950 |
aataggtctttacccctgtaatataggacacttttggttttg |
38935991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 132 - 190
Target Start/End: Original strand, 44366863 - 44366923
Alignment:
Q |
132 |
aatttggtcaataggtcttta--tccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||| ||| |||||||||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
44366863 |
aattgggttaataggtctttaactccctgtaatatagggcacttttggttttgccccctgt |
44366923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 7576330 - 7576381
Alignment:
Q |
141 |
aataggtctttatccc--tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||||| ||||||||||| |||||||||||||| ||||||| |
|
|
T |
7576330 |
aataggtctttatccccctgtaatatagggcacttttggttttgccccctgt |
7576381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 141 - 181
Target Start/End: Complemental strand, 9012036 - 9011996
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||||||||||||||||| ||| |||||||||| |
|
|
T |
9012036 |
aataggtctttatccctgtaatatagttcatttttggtttt |
9011996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 183
Target Start/End: Complemental strand, 5970805 - 5970763
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgt |
183 |
Q |
|
|
|||||||||||| |||||||||||||| |||||||||||||| |
|
|
T |
5970805 |
aataggtctttacccctgtaatatagggtacttttggttttgt |
5970763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 15809427 - 15809377
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||||| || |||||||||||||||||||||| ||||||| |
|
|
T |
15809427 |
aataggtctttatcccctgcaatataggtcacttttggttttcacccctgt |
15809377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 16670504 - 16670554
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||||||||| ||||||| |
|
|
T |
16670504 |
aataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
16670554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 30371390 - 30371440
Alignment:
Q |
141 |
aataggtcttta-tccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| |||||||||||||||||| |||||||||| ||||||| |
|
|
T |
30371390 |
aataggtctttactccctgtaatataggtcatttttggttttcccccctgt |
30371440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 181
Target Start/End: Original strand, 11101106 - 11101139
Alignment:
Q |
148 |
ctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| |
|
|
T |
11101106 |
ctttatccctgtaatataggacacttttggtttt |
11101139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 181
Target Start/End: Original strand, 18701556 - 18701597
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||||||| |||||||||||||| |||||||||| |
|
|
T |
18701556 |
aataggtctttatcccctgtaatataggtcatttttggtttt |
18701597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 181
Target Start/End: Complemental strand, 28484644 - 28484603
Alignment:
Q |
141 |
aataggtcttta-tccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||| |||||||||||||||||| |||||||||| |
|
|
T |
28484644 |
aataggtctttactccctgtaatataggtcatttttggtttt |
28484603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 186
Target Start/End: Complemental strand, 29098300 - 29098256
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggttttgtccc |
186 |
Q |
|
|
|||||||||||| ||||||||||||||||| |||||||||| |||| |
|
|
T |
29098300 |
aataggtcttta-ccctgtaatataggtcatttttggttttctccc |
29098256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 300
Target Start/End: Complemental strand, 34404528 - 34404483
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||||||| |||||||||||| | ||||||| |||| |
|
|
T |
34404528 |
gctgactgtgcatttttgatgatgtggcatgattcgtcaccttttt |
34404483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 1902950 - 1902986
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
1902950 |
ccctgtaatatagggcacttttggttttgccccctgt |
1902986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 1904446 - 1904410
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
1904446 |
ccctgtaatatagggcacttttggttttgccccctgt |
1904410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 15749046 - 15749010
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| |||||||||||||||| ||||||| |
|
|
T |
15749046 |
ccctgtaatatatgtcacttttggttttgccccctgt |
15749010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 19684222 - 19684258
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| | |||||||||||||||||||||| |
|
|
T |
19684222 |
ccctgtaatatatgacacttttggttttgtcccctgt |
19684258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 23834601 - 23834637
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
T |
23834601 |
ccctgtaatatagggcacttttggttttgccccctgt |
23834637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 182
Target Start/End: Complemental strand, 28462531 - 28462503
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttg |
182 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
28462531 |
ccctgtaatataggtcacttttggttttg |
28462503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 181
Target Start/End: Original strand, 37200352 - 37200392
Alignment:
Q |
141 |
aataggtctttatccctgtaatataggtcacttttggtttt |
181 |
Q |
|
|
|||||||||||| ||||||||||||||||| ||| |||||| |
|
|
T |
37200352 |
aataggtctttacccctgtaatataggtcattttcggtttt |
37200392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 188
Target Start/End: Complemental strand, 38937560 - 38937512
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccct |
188 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||||||||| ||||| |
|
|
T |
38937560 |
aataggtctttaccccctgtaatatagggcacttttggttttgccccct |
38937512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 39341285 - 39341321
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||||||| |||||||||| |||||||| |
|
|
T |
39341285 |
ccctgtaatataggtcatttttggttttctcccctgt |
39341321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 253 - 301
Target Start/End: Complemental strand, 45323833 - 45323785
Alignment:
Q |
253 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacccttttt |
301 |
Q |
|
|
|||||||||||||||||||||||| |||||| | || |||||| ||||| |
|
|
T |
45323833 |
cagctgactgtgcatttttgctgacgtggcacgctgagtcacctttttt |
45323785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 237 - 300
Target Start/End: Complemental strand, 111499 - 111436
Alignment:
Q |
237 |
gaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||| || ||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
T |
111499 |
gaaaacccctctagaccagctgactatgcatttttgctgatgtggcatgatgcgtcaccttttt |
111436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 2)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 231 - 300
Target Start/End: Complemental strand, 228549 - 228480
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
||||||||||||||| || || |||||||||||||||||||||||||||||||| | ||||||| |||| |
|
|
T |
228549 |
gttttggaaaacccccctagactagctgactgtgcatttttgctgatgtggcatgctccgtcaccttttt |
228480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 285
Target Start/End: Original strand, 227374 - 227521
Alignment:
Q |
141 |
aataggtcttta--tccctgtaatataggtcacttttggttttgtcccctgtnnnnnnnnnnnttta-gatttggtccttgtaaaannnnnnngttttgg |
237 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||| ||||| | ||| |||| ||||||||||||| ||||||| |
|
|
T |
227374 |
aataggtctttacctccctgtaatataggtcacttttggttttgccccctataatttttattttttttgattcggtccttgtaaaatgtttttgttttgg |
227473 |
T |
 |
Q |
238 |
aaaacccctctggatcagctgactgtgcatttttgctgatgtggcatg |
285 |
Q |
|
|
|||||||| || | ||||||||||||||||||| |||||||||||| |
|
|
T |
227474 |
aaaacccccctaaacaagctgactgtgcatttttgttgatgtggcatg |
227521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 255 - 300
Target Start/End: Original strand, 10474 - 10519
Alignment:
Q |
255 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcaccctttt |
300 |
Q |
|
|
|||||||||||||||||||| |||||||||| ||||||||| |||| |
|
|
T |
10474 |
gctgactgtgcatttttgcttatgtggcatgatgcgtcaccttttt |
10519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 257 - 293
Target Start/End: Original strand, 4687 - 4723
Alignment:
Q |
257 |
tgactgtgcatttttgctgatgtggcatgttgcgtca |
293 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| |
|
|
T |
4687 |
tgactgtgcatttttgctgatgtggcatgatgcgtca |
4723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 231 - 283
Target Start/End: Original strand, 14926 - 14978
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggca |
283 |
Q |
|
|
||||||||||||||| || | |||||||||||||||||| |||||||||||| |
|
|
T |
14926 |
gttttggaaaacccccctaggccagctgactgtgcattttcgctgatgtggca |
14978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 15877 - 15927
Alignment:
Q |
141 |
aataggtctttatccc-tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||||||| ||||||||| | ||||||| |||||||||||||| |
|
|
T |
15877 |
aataggtctttatcccctgtaatatatgacactttttgttttgtcccctgt |
15927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0136 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0136
Description:
Target: scaffold0136; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 231 - 285
Target Start/End: Complemental strand, 36704 - 36650
Alignment:
Q |
231 |
gttttggaaaacccctctggatcagctgactgtgcatttttgctgatgtggcatg |
285 |
Q |
|
|
||||||||||||||| || | ||| ||||||| ||||||||||||||||||||| |
|
|
T |
36704 |
gttttggaaaacccccctaggccagttgactgtacatttttgctgatgtggcatg |
36650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1797 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold1797
Description:
Target: scaffold1797; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 190
Target Start/End: Complemental strand, 716 - 680
Alignment:
Q |
154 |
ccctgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
||||||||||||||||| |||||||||| |||||||| |
|
|
T |
716 |
ccctgtaatataggtcatttttggttttctcccctgt |
680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 340 - 289
Alignment:
Q |
141 |
aataggtctttatccc--tgtaatataggtcacttttggttttgtcccctgt |
190 |
Q |
|
|
|||||||||||| ||| ||||||||||| |||||||||||||| ||||||| |
|
|
T |
340 |
aataggtctttacccccatgtaatatagggcacttttggttttgccccctgt |
289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University