View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0936_high_14 (Length: 300)
Name: NF0936_high_14
Description: NF0936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0936_high_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 30 - 300
Target Start/End: Original strand, 28088946 - 28089216
Alignment:
| Q |
30 |
cttcattatgctaatgaaatttctgcttcgtcttcctcaactgtaaatcatgaaataaagggtgctgatgatgctgctgatcaatcatttgccgatgagt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28088946 |
cttcattatgctaatgaaatttctgcttcgtcttcctcaactgtaaatcatgaaataaagggtgctgatgatgctgctgatcaatcatttgccgatgagt |
28089045 |
T |
|
| Q |
130 |
tttgggaggatatgaaaagtaatgtgcagttgcataaagatcgtatagaggcaaccttcttatcgactaaggacttatcaggccgaataactcctggtgt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28089046 |
tttgggaggatatgaaaagtaatgtgcagttgcataaagatcgtatagaggcaaccttcttatcgactaaggacttatctggccgaataactcctggtgt |
28089145 |
T |
|
| Q |
230 |
aggtcggcagtatagatactaccttgggcggtatgaaattctatgatttaatattgatacaattgcccttg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28089146 |
aggtcggcagtatagatactaccttgggcggtatgaaattctatgatttaatattgatacaattgcccttg |
28089216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University