View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0936_high_18 (Length: 265)
Name: NF0936_high_18
Description: NF0936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0936_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 38644403 - 38644284
Alignment:
Q |
1 |
tcatcaatatgcagtgcttcatctcttcttcatttttcacttgtttggtccctgaactagaattttccaatgtaaaacacaaccacatcatcttctggga |
100 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||| |
|
|
T |
38644403 |
tcatcaatatgcagtgcttcatttcttcttcatttttcacttgtttggtccctgaactagaatttt--aatgtaaaacacaataacatcatcttcaggga |
38644306 |
T |
 |
Q |
101 |
acaagtgtaacaaaattaacaa |
122 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
38644305 |
acaagtgtaacaaaattaacaa |
38644284 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 200 - 233
Target Start/End: Complemental strand, 38644206 - 38644173
Alignment:
Q |
200 |
cgtcgtttgtgtccccaacaaccttcggcggtgg |
233 |
Q |
|
|
|||||||||||||||||||||||| ||||||||| |
|
|
T |
38644206 |
cgtcgtttgtgtccccaacaacctccggcggtgg |
38644173 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 39272941 - 39272986
Alignment:
Q |
1 |
tcatcaatatgcagtgcttcatctcttcttcatttttcacttgttt |
46 |
Q |
|
|
||||||||||||| ||| | || ||||||||||||||||||||||| |
|
|
T |
39272941 |
tcatcaatatgcaatgcataatttcttcttcatttttcacttgttt |
39272986 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University