View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0936_high_18 (Length: 265)

Name: NF0936_high_18
Description: NF0936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0936_high_18
NF0936_high_18
[»] chr7 (2 HSPs)
chr7 (1-122)||(38644284-38644403)
chr7 (200-233)||(38644173-38644206)
[»] chr2 (1 HSPs)
chr2 (1-46)||(39272941-39272986)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 38644403 - 38644284
Alignment:
1 tcatcaatatgcagtgcttcatctcttcttcatttttcacttgtttggtccctgaactagaattttccaatgtaaaacacaaccacatcatcttctggga 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||  ||||||||||| ||||    
38644403 tcatcaatatgcagtgcttcatttcttcttcatttttcacttgtttggtccctgaactagaatttt--aatgtaaaacacaataacatcatcttcaggga 38644306  T
101 acaagtgtaacaaaattaacaa 122  Q
    ||||||||||||||||||||||    
38644305 acaagtgtaacaaaattaacaa 38644284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 200 - 233
Target Start/End: Complemental strand, 38644206 - 38644173
Alignment:
200 cgtcgtttgtgtccccaacaaccttcggcggtgg 233  Q
    |||||||||||||||||||||||| |||||||||    
38644206 cgtcgtttgtgtccccaacaacctccggcggtgg 38644173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 39272941 - 39272986
Alignment:
1 tcatcaatatgcagtgcttcatctcttcttcatttttcacttgttt 46  Q
    ||||||||||||| ||| | || |||||||||||||||||||||||    
39272941 tcatcaatatgcaatgcataatttcttcttcatttttcacttgttt 39272986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University