View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0936_low_17 (Length: 334)
Name: NF0936_low_17
Description: NF0936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0936_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 104 - 262
Target Start/End: Original strand, 43148592 - 43148750
Alignment:
| Q |
104 |
gttctttcaactacatagcagccattcatttcctttcagctacatacataactaccatcccttttcaaccctctgtctatgttacatgtttctttaattt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43148592 |
gttctttcaactacatagcagccattcatttcctttcagctacatacataaccaccatcccttttcaaccctctgtctatgttacatgtttctttaattt |
43148691 |
T |
|
| Q |
204 |
aaggtgtttatcatttatgtgctgtcgacttttggttggatgtgcccctatgctactcc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
43148692 |
aaggtgtttatcatttatgtgctgtcgacttttggttggatgtgcccatatgttactcc |
43148750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University