View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0936_low_17 (Length: 334)

Name: NF0936_low_17
Description: NF0936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0936_low_17
NF0936_low_17
[»] chr8 (1 HSPs)
chr8 (104-262)||(43148592-43148750)


Alignment Details
Target: chr8 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 104 - 262
Target Start/End: Original strand, 43148592 - 43148750
Alignment:
104 gttctttcaactacatagcagccattcatttcctttcagctacatacataactaccatcccttttcaaccctctgtctatgttacatgtttctttaattt 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
43148592 gttctttcaactacatagcagccattcatttcctttcagctacatacataaccaccatcccttttcaaccctctgtctatgttacatgtttctttaattt 43148691  T
204 aaggtgtttatcatttatgtgctgtcgacttttggttggatgtgcccctatgctactcc 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||    
43148692 aaggtgtttatcatttatgtgctgtcgacttttggttggatgtgcccatatgttactcc 43148750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University