View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0936_low_20 (Length: 312)
Name: NF0936_low_20
Description: NF0936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0936_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 11 - 235
Target Start/End: Original strand, 39169170 - 39169387
Alignment:
Q |
11 |
cagagaacactttacaagaccctctctctgttccattggaggagttgcaagattaaaaaatctaacctacgttgatgnnnnnnnnnnnattccaataata |
110 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| || |||||| |||||||||||| |
|
|
T |
39169170 |
cagagaacactttacaagaccctcc----gttccattggaggagttgcaagattaaaaaatataacttatgttgat---tttttttttattccaataata |
39169262 |
T |
 |
Q |
111 |
ataagaacaagaagatgcttttcatttatattaggttctttcaatttgcaatttctgtttcatggttatgnnnnnnnactttccaataacaagaacaaga |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
T |
39169263 |
ataagaacaagaagatgcttttcatttatattaggttctttcaatttgcaatttctgtttcatgtttatgtttttttactttccaataacaagaacaaga |
39169362 |
T |
 |
Q |
211 |
cataggttgtttaaatttgcaattt |
235 |
Q |
|
|
||||||| ||||||||||||||||| |
|
|
T |
39169363 |
cataggtggtttaaatttgcaattt |
39169387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 40418724 - 40418781
Alignment:
Q |
121 |
gaagatgcttttcatttatattaggttctttcaatttgcaatttctgtttcatggttatg |
180 |
Q |
|
|
||||||||||||||||||| ||||||||||| ||||||||||| ||||||||| ||||| |
|
|
T |
40418724 |
gaagatgcttttcatttat--taggttctttctatttgcaatttttgtttcatgtttatg |
40418781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 139 - 180
Target Start/End: Original strand, 38988162 - 38988203
Alignment:
Q |
139 |
tattaggttctttcaatttgcaatttctgtttcatggttatg |
180 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||| ||||| |
|
|
T |
38988162 |
tattaggttctttctatttgcaatttctgtttcatgtttatg |
38988203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 281
Target Start/End: Complemental strand, 51106433 - 51106392
Alignment:
Q |
240 |
ataagatgattcgagatcaataatccaaatcataactctcga |
281 |
Q |
|
|
||||||||| |||||||||||| |||||| |||||||||||| |
|
|
T |
51106433 |
ataagatgactcgagatcaatattccaaaccataactctcga |
51106392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University