View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0936_low_30 (Length: 251)
Name: NF0936_low_30
Description: NF0936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0936_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 35233662 - 35233492
Alignment:
| Q |
1 |
cacgacttccacctagctagagagtgaatgttagagattgtgtgaacaagaagttgatatgaccgaaaagaattatctcttgttgattttggccaaacca |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||| |||||||||| |
|
|
| T |
35233662 |
cacgacttccacctagttagagagtgaatgttagagattgtgtgaacaagaagttgatatgatggaaaaggattatctcctgttgatttcggccaaacca |
35233563 |
T |
|
| Q |
101 |
ctagactatatgtgctaatagtaccgtactgctataagaaaaatgatatttgcacaaccattttacgataa |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35233562 |
ctagactatatgtgctaatagtaccgtactgctataagaaaaatgatatttgcacaaccattttacgataa |
35233492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 164
Target Start/End: Complemental strand, 16829729 - 16829701
Alignment:
| Q |
136 |
aagaaaaatgatatttgcacaaccatttt |
164 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16829729 |
aagaaaaatgatatttgcacaaccatttt |
16829701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University