View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0936_low_33 (Length: 251)
Name: NF0936_low_33
Description: NF0936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0936_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 36038521 - 36038283
Alignment:
| Q |
1 |
tggtgcagaattgtttcaagaaaaccaaaagatgtgtgggcagtacggctcagcattggaacttatcttattgatggcaaatatttcaagcccttagatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36038521 |
tggtgcagaattgtttcaagaaaaccaaaagatgtgtgggcagtacggctcagcattggaacttatcttattgatggcaaatatttcaagcccttagatc |
36038422 |
T |
 |
| Q |
101 |
tggctcagaatagctagctgaataa-ccattcacaaattgtggactttgttttaaaatatgtcaagcaaaatattatattggcaaaatttcacttgtccc |
199 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
36038421 |
tggctcagaatagctagctgaataacccattcacaaattgtggactttgttttaaaatatgtcaagcaaaatattatattgacaaaatttcacttctccc |
36038322 |
T |
 |
| Q |
200 |
ttaacttaattttaaatcacgatttcattttttatcttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36038321 |
ttaacttaattttaaatcacgatttcgttttttatcttc |
36038283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 4 - 151
Target Start/End: Complemental strand, 36008632 - 36008485
Alignment:
| Q |
4 |
tgcagaattgtttcaagaaaaccaaaagatgtgtgggcagtacggctcagcattggaacttatcttattgatggcaaatatttcaagcccttagatctgg |
103 |
Q |
| |
|
|||||||||||||||| ||| | | |||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36008632 |
tgcagaattgtttcaaaaaagcaagaagatgtgtgggcagtgcggcgcagcattggaacttatattattgatggcaaatatttcaagcccttagatctgg |
36008533 |
T |
 |
| Q |
104 |
ctcagaatagctagctgaataaccattcacaaattgtggactttgttt |
151 |
Q |
| |
|
|| || |||| ||||||| |||||| || |||||||||||||||||| |
|
|
| T |
36008532 |
ctgagtatagttagctgattaaccacgcataaattgtggactttgttt |
36008485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University