View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0936_low_34 (Length: 247)
Name: NF0936_low_34
Description: NF0936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0936_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 91 - 240
Target Start/End: Complemental strand, 35956281 - 35956131
Alignment:
| Q |
91 |
ttttcctgatgacttcagtaccaaccatgcgaatttctctctagtgttcttgttcgagacaacaaaaacttcacagtggtcatttcaaatgagtatatct |
190 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35956281 |
ttttcctgacgacttcagtaccaaccatgcgaatttctctctagcattcttgttcgagacaacaaaaacttcacagtggtcatttcaaatgagtatatct |
35956182 |
T |
|
| Q |
191 |
ctagc-nnnnnnnattcttttcttcttgttcaaccgtttaaaatattattg |
240 |
Q |
| |
|
||||| || ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
35956181 |
ctagcttttttttatccttttcttcttgttcaaacgtttaaaatactattg |
35956131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 35956668 - 35956620
Alignment:
| Q |
20 |
agattctctaaacacttatttatgtgaacttttgcttattttagtttga |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35956668 |
agattctctaaacacttatttatgtgaacttttgcttattttagtttga |
35956620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University