View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0936_low_37 (Length: 210)
Name: NF0936_low_37
Description: NF0936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0936_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 39436580 - 39436692
Alignment:
Q |
1 |
catgaactcatctagttgtaaatatcgtgcatatgaaagataaaaagtgttccaaaagataatgaaaatgtaatcattttggcaaaattttcagcttatt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39436580 |
catgaactcatctagttgtaaatatcgtgcatatgaaagataaaaagtgttccaaaagataatgaaaatgtaatcattttggcaaaattttcagcttatt |
39436679 |
T |
 |
Q |
101 |
aattaggcctatg |
113 |
Q |
|
|
||||||||||||| |
|
|
T |
39436680 |
aattaggcctatg |
39436692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University