View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0937_high_20 (Length: 251)
Name: NF0937_high_20
Description: NF0937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0937_high_20 |
 | |
|
| [»] scaffold0364 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0364 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: scaffold0364
Description:
Target: scaffold0364; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 33 - 251
Target Start/End: Complemental strand, 12978 - 12761
Alignment:
| Q |
33 |
tttagtcccaatgagtagtgaatctttccccacctcaaaattgacaagataattaactaagcattaaagctcaaacaaaaacacaatagaaatcaaggtt |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12978 |
tttagtcccaatgtttagtgaatctttccccacctcaaaatttacaagataattaactaagcattaaagctcaaacaaaaacacaatagaaatcaaggtt |
12879 |
T |
|
| Q |
133 |
attacaacctttaaaactatgagagattgttgcatttcaacctttcgtagcttgaaatccaaaaatatttattcatattttgtgattttcccttttctct |
232 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12878 |
attacaacctttaaaactatgagaggttgttgcatttcaacctttcgtagcttgaaatccaaaaata-ttattcatattttgtgattttcccttttctct |
12780 |
T |
|
| Q |
233 |
catgaaaggttctaaaata |
251 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12779 |
catgaaaggttctaaaata |
12761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University