View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0937_high_22 (Length: 250)
Name: NF0937_high_22
Description: NF0937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0937_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 21013466 - 21013249
Alignment:
| Q |
20 |
attgtatggtcttagtccctagattttcgtttaatgtttttaactttcatgtgattgttggtagcactgaggtaaagttctgttagtacaaaggattgct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21013466 |
attgtatggtcttagtccctagattttcgtttaatgtttttaactttcatttgattgttggtagcactgaggtaaatttctgttagtacaaaggattgct |
21013367 |
T |
|
| Q |
120 |
caaatttgtaacttcttgtgatgggttctctgcaacttgtatcttcctcagtagtatagttattgtatttactgctgcatctttgtattttttatctgct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21013366 |
caaatttgtaacttcttgtgatgggttctctgcaacttgtatcttcctc---agtatagttattgtatttactgctgcatctttgtattttttatctgct |
21013270 |
T |
|
| Q |
220 |
gcattggaatctgtgtctgtg |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
21013269 |
gcattggaatctgtgtctgtg |
21013249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 26 - 235
Target Start/End: Complemental strand, 20962017 - 20961807
Alignment:
| Q |
26 |
tggtcttagtccctagattttcgtttaatgtttttaactttcatgtgattgttggtagcactgaggtaaagttctgttagtacaaaggattgctcaaatt |
125 |
Q |
| |
|
||||||| || |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20962017 |
tggtctttgtgcctagattttcgtttattgtttttaactttcatgtgattgttggtagcactgaggtaaagttctgttagtacaaaggattgctcaaatt |
20961918 |
T |
|
| Q |
126 |
tgtaactt------cttgtgatgggttctctgcaacttgtatcttcctcagtagtatagttattgtatttactgctgcatctttgtattttttatctgct |
219 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20961917 |
tgtaacttctgtgacttgtgataggttctctgcaacttgtatctctctc---agtatagttat--tatttactgctgcatctttgtattttttatctgct |
20961823 |
T |
|
| Q |
220 |
gcattggaatctgtgt |
235 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
20961822 |
acattggaatctgtgt |
20961807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University