View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0937_low_18 (Length: 312)
Name: NF0937_low_18
Description: NF0937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0937_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 19 - 299
Target Start/End: Complemental strand, 861902 - 861622
Alignment:
Q |
19 |
ggacatcatcaaaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgct |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
861902 |
ggacatcatcaaaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgct |
861803 |
T |
 |
Q |
119 |
atattgctgactctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggta |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
861802 |
atattgctgactctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggta |
861703 |
T |
 |
Q |
219 |
tctacatttctgctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtct |
299 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
861702 |
tctacatttctgctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtct |
861622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 19 - 299
Target Start/End: Complemental strand, 1223179 - 1222899
Alignment:
Q |
19 |
ggacatcatcaaaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgct |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1223179 |
ggacatcatcaaaactgcccgtcattctgatgatgatatctcaatttatggctttatagctgggaagcctacctggccctcttggctgcttattattgct |
1223080 |
T |
 |
Q |
119 |
atattgctgactctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggta |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1223079 |
atattgctgactctagcatccattacatcaatcatacccattaaatacattgttgaactaaggactgtttactccattgctatgggtgttgcccttggta |
1222980 |
T |
 |
Q |
219 |
tctacatttctgctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtct |
299 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1222979 |
tctacatttctgctgaattctttgtctgggcatttgttttggatgttctcattgttgtcaccatggtttgtgcctctgtct |
1222899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University