View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0937_low_25 (Length: 272)
Name: NF0937_low_25
Description: NF0937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0937_low_25 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 272
Target Start/End: Complemental strand, 35805927 - 35805666
Alignment:
| Q |
11 |
ccaacaatatcacaccaccaccatcaaaattgtgataaatataaatctccaccacgcaattgcatatgaatttattaatgtaaattaagaggctagtttg |
110 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35805927 |
ccaacaaaatcataccaccaccatcaaaattgtgataaatataaatctccaccacgcaattgcatatgaatttattaatgtaaattaagaggctagtttg |
35805828 |
T |
 |
| Q |
111 |
taaattaagaggctagttagaattgaagttaaacaacaccacttgctggccttgtccacaacatgaagaccactcaaggtagccatgagggttgctttca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35805827 |
taaattaagaggctagttagaattgaagtgaaacaacaccacttgttggccttgtccacaacatgaagaccactcaaggtagccatgagggttgctttca |
35805728 |
T |
 |
| Q |
211 |
aatgtctcatgagatatatgtactattcaccaccaccggtgcttacataattcccccaccac |
272 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35805727 |
aatgtctcatgagatatatgtacgattcaccaccaccggtgcttacataattcccccaccac |
35805666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University