View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0937_low_26 (Length: 270)
Name: NF0937_low_26
Description: NF0937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0937_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 46 - 241
Target Start/End: Original strand, 38348534 - 38348729
Alignment:
| Q |
46 |
taagtaaccctaaccttgactaggtcatgctgtgacagcctcactctttcctattttgtggaccaagttcctaatcctaacgatctcttcaacatactga |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38348534 |
taagtaaccctaaccttgactaggtcatgctgtgacagcctcactctttcctattttgtggaccaagttcctaatcctaacgatctcttcaacatactga |
38348633 |
T |
 |
| Q |
146 |
aagacgcacaacaaactttaaacctaaaaggtgagtgaaattactgttagaagaagcatctctcgtttattcctttcttagtttctgttatattct |
241 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38348634 |
aagacacacaacaaactttaaacctaaaaggtgagtgaaattactgttagaagaagcatctctcgtttattcctttcttagtttctgttatgttct |
38348729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 56 - 101
Target Start/End: Complemental strand, 31573108 - 31573063
Alignment:
| Q |
56 |
taaccttgactaggtcatgctgtgacagcctcactctttcctattt |
101 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
31573108 |
taaccctgactaggtcatgctgtgctagcctcactccttcctattt |
31573063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University